ID: 1192631479

View in Genome Browser
Species Human (GRCh38)
Location X:72781091-72781113
Sequence CCCACGGGTGCTCCCAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192631479_1192631485 26 Left 1192631479 X:72781091-72781113 CCCACTCTGGGAGCACCCGTGGG 0: 2
1: 0
2: 0
3: 7
4: 121
Right 1192631485 X:72781140-72781162 CAGATCAATGTAATTTGACGTGG 0: 2
1: 0
2: 0
3: 1
4: 81
1192631479_1192631486 27 Left 1192631479 X:72781091-72781113 CCCACTCTGGGAGCACCCGTGGG 0: 2
1: 0
2: 0
3: 7
4: 121
Right 1192631486 X:72781141-72781163 AGATCAATGTAATTTGACGTGGG 0: 2
1: 0
2: 0
3: 1
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192631479 Original CRISPR CCCACGGGTGCTCCCAGAGT GGG (reversed) Intronic
900104520 1:976649-976671 CCCACGGCTGCACTCAGAGATGG + Intronic
900374791 1:2348553-2348575 CCCACGGGCCCTGCCAGAGCCGG + Intronic
900384132 1:2401603-2401625 TCCTCCTGTGCTCCCAGAGTGGG - Intronic
900582647 1:3416659-3416681 CCCCTGGGAGCTCCCAGAGAAGG - Intronic
901228449 1:7628715-7628737 CCCACTTCTGCTCCCAGAGCTGG - Intronic
901512072 1:9722403-9722425 TCCTGGGGTGCTCCTAGAGTGGG + Intronic
908085012 1:60622626-60622648 CCCACGGGTGCTCCAAATGTGGG + Intergenic
915080161 1:153346390-153346412 CCCAGGGGATTTCCCAGAGTTGG - Intronic
918767045 1:188499838-188499860 CCCAAGGCTGCTCACAGAGTTGG - Intergenic
920161075 1:203997916-203997938 CCCACGGGGGCAGCCATAGTGGG - Intergenic
1064553107 10:16521709-16521731 CCCCCGGGTGCGCCCAGCGGCGG + Exonic
1072628472 10:97129644-97129666 GCCACGGGTCCTCCCAGGGCAGG - Intronic
1075399355 10:122150164-122150186 CCCAGCTGTGCCCCCAGAGTAGG - Intronic
1076146286 10:128125236-128125258 CCCCCGGGTGCCTCCACAGTGGG - Intronic
1076978836 11:194678-194700 CGCACGTGTGCTCCTTGAGTGGG - Intronic
1076978855 11:194784-194806 CGCACGTGTGCTCCTTGAGTAGG - Intronic
1077140090 11:1020458-1020480 CCCACGGATGAGCACAGAGTGGG - Intronic
1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG + Intronic
1078307669 11:10206210-10206232 CCCACTGGTGCTGCCTGAGGTGG - Intronic
1081570625 11:44288618-44288640 GCAATGTGTGCTCCCAGAGTTGG - Intronic
1084176166 11:67423473-67423495 CGCACGGCTGCTGGCAGAGTTGG + Exonic
1089742869 11:120597108-120597130 TCAACGGCTGCTCCCAGAGCTGG + Intronic
1091888187 12:4031703-4031725 CCCTCGGGGCCGCCCAGAGTCGG - Intergenic
1096045477 12:48558470-48558492 CCCTCGTGGGTTCCCAGAGTGGG - Intergenic
1098539703 12:71640503-71640525 ACCACTGGTGGTCCCAGAGCAGG - Intronic
1102940693 12:116938912-116938934 CCCATGGATGCACCCAGACTGGG - Intronic
1104296234 12:127516650-127516672 CCCAGTGTTGCTCACAGAGTTGG + Intergenic
1104955741 12:132465069-132465091 CCTGCAGGTGCTCCCAGAGGCGG + Intergenic
1105017409 12:132794107-132794129 CCCACAGCGGCTCCCACAGTGGG + Intronic
1115349985 14:32383648-32383670 CCCCAGGGAGCTCCCAGAGCAGG - Intronic
1118892652 14:69922898-69922920 CCCAGGGGTGGTCCTAGAGCAGG + Intronic
1119849650 14:77858030-77858052 CTCACCGGTCCTTCCAGAGTTGG - Intronic
1120935695 14:89893136-89893158 CCCAGGAATGCTGCCAGAGTGGG - Intronic
1202862284 14_GL000225v1_random:90278-90300 CCCACTGGTGCTCCCTCAGCTGG + Intergenic
1129058361 15:72838647-72838669 GCCACAGGAGCTCCCACAGTGGG - Intergenic
1130274525 15:82469508-82469530 CCCACGGGGGCACCCTGAGGTGG + Intergenic
1130466873 15:84196882-84196904 CCCACGGGGGCACCCTGAGGTGG + Intergenic
1130497391 15:84476654-84476676 CCCACGGGGGCACCCTGAGGTGG - Intergenic
1130589167 15:85201475-85201497 CCCACGGGGGCACCCTGAGGTGG + Intergenic
1132668169 16:1091220-1091242 CCCACAGGTGCACCCAGCGTGGG - Intronic
1133455703 16:5940648-5940670 ACCACGGGTGCTCCCACTATGGG - Intergenic
1140257401 16:73349109-73349131 CCCTCGGGAGATCCCTGAGTGGG - Intergenic
1141689133 16:85586694-85586716 CACACGGCTGCTCTCAGAGGTGG - Intergenic
1141767684 16:86069746-86069768 GCCATGGGTGGCCCCAGAGTTGG + Intergenic
1142466283 17:139276-139298 CGCACGTGTGCTCCTTGAGTAGG - Intergenic
1142466322 17:139489-139511 CGCACGTGTGCTCCTTGAGTGGG - Intergenic
1143882414 17:10039836-10039858 CCCTCTGGGGCTCCCAGAGGGGG + Intronic
1144807928 17:17979800-17979822 CCCACCTGTGCTTCCAGGGTGGG - Intronic
1148481953 17:47965729-47965751 CCCACAGGTACTCGCAGACTAGG + Intergenic
1149543354 17:57485106-57485128 CAAATGGGTGTTCCCAGAGTGGG + Intronic
1151465873 17:74284941-74284963 CCCACGGGGGCTCCCAGGGCTGG - Intronic
1154325356 18:13387196-13387218 CCCACAGGGGCTGCCAGGGTGGG - Intronic
1155332702 18:24733994-24734016 ATCACGGGTTCTCCAAGAGTTGG - Intergenic
1155972133 18:32092543-32092565 CCCACGGCTCCTCCCACAGGGGG - Intronic
1161725391 19:5925471-5925493 CCCAAGGTTGTGCCCAGAGTGGG + Intronic
1162029226 19:7910180-7910202 CCCACTGGCGCTCCCAGGATGGG - Intronic
1165061163 19:33205874-33205896 CGCACGGCTGCTCCCAGGGGAGG - Exonic
1165912559 19:39238080-39238102 GCCACGGGTGCCCCCAGGGCAGG + Intergenic
1167298930 19:48668092-48668114 CCCACAGGTGCTTCCAGACCAGG - Intronic
927112413 2:19873170-19873192 ACCACGTGTGCTCCAAGAATAGG - Intergenic
928434528 2:31246008-31246030 CCAAGGTGTGCGCCCAGAGTAGG + Intronic
930023223 2:47013919-47013941 CCCATGGGTGGCCCGAGAGTGGG + Intronic
944206206 2:197161181-197161203 GACACGAGTGCTCCCAGAATTGG + Intronic
947304567 2:228729587-228729609 CCAACGTGGGCTTCCAGAGTAGG - Intergenic
948675571 2:239594711-239594733 GCCATGGAAGCTCCCAGAGTGGG + Intergenic
948688344 2:239685824-239685846 CCCACGAGCTCTCCCAGAGCAGG - Intergenic
948755900 2:240159425-240159447 ATCTCGGGTGCTCCCAGGGTGGG - Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1175819399 20:61900516-61900538 CCCCAGGGTGGACCCAGAGTTGG - Intronic
1175997254 20:62817349-62817371 CCCCCTTGTGCTCCCAGAGGAGG - Intronic
1179494183 21:41761265-41761287 CCAACCGGTGTTCCCAGAGGAGG - Intronic
1180059481 21:45377202-45377224 CCAAGGGCTGCTCCCAGAGGGGG - Intergenic
1180181169 21:46119278-46119300 CCCACGGGACCCCCCAGAGCTGG + Intronic
1181572110 22:23773216-23773238 CTCACGCTTGCTCCCAGCGTGGG + Intronic
1182260619 22:29071374-29071396 CCCACGGCTGCTCGCAGGGCCGG - Intergenic
1183301875 22:37062661-37062683 CCCACGGGTGCAGACAGAGGAGG - Exonic
1184034332 22:41911278-41911300 CCCAGGGGTGGGCCCAGGGTGGG + Exonic
1184971814 22:48027838-48027860 CCCCCATGTGCTCTCAGAGTCGG + Intergenic
1185076514 22:48686037-48686059 CCCACGTGTGCCCCGGGAGTTGG + Intronic
950442088 3:13016092-13016114 CCCAGGGGTGGTGCCAGGGTAGG + Intronic
950729346 3:14943499-14943521 CCTACGGGGGCTCGCAGTGTGGG + Intergenic
953620137 3:44525912-44525934 CACCGGGGTGCTCCCAGGGTTGG + Intergenic
962722395 3:138187797-138187819 CCGGCGGGAGCTCCCGGAGTTGG - Intronic
964710754 3:159668994-159669016 TCCCCTAGTGCTCCCAGAGTAGG + Intronic
968780102 4:2573922-2573944 CCTAAGGGTGCTCCCAGACGAGG - Intronic
972222679 4:36974265-36974287 ACCATGAATGCTCCCAGAGTGGG - Intergenic
980022171 4:127722947-127722969 CTCACGGGAGTTCCCAGAGCCGG + Exonic
981802697 4:148676990-148677012 CCCACAGAAGCTCCCAGAGAGGG - Intergenic
986685519 5:10272553-10272575 CCCTGGGGTGCTCTCTGAGTTGG + Intergenic
990819064 5:59817059-59817081 CACACTAGTGTTCCCAGAGTGGG - Intronic
992700308 5:79335124-79335146 CTCAGGAGTGCTCCCACAGTGGG + Intergenic
993097244 5:83493808-83493830 CCCATCCGGGCTCCCAGAGTAGG + Exonic
999617648 5:153441884-153441906 CCATGGGGTGCTCCTAGAGTTGG - Intergenic
1000598500 5:163244219-163244241 CCTACTGCTTCTCCCAGAGTGGG - Intergenic
1001516153 5:172356600-172356622 GGCACGGGTGGTCCCAGAGCAGG + Intronic
1002898549 6:1392862-1392884 CCCCCGGGCGTTCCCAGACTCGG - Intronic
1005498284 6:26407799-26407821 ACCACAGGTGCTTCCACAGTCGG - Exonic
1012400972 6:98842877-98842899 GCCACGCGTGCCCCCAGAGAGGG - Intergenic
1015261630 6:131244305-131244327 TCAACGGGTGCCACCAGAGTAGG - Intronic
1015718345 6:136214873-136214895 CCCACAGGTCCTTCCAGAGATGG - Intergenic
1018395323 6:163373887-163373909 CCCACAGGTGGCACCAGAGTGGG + Intergenic
1018982046 6:168608418-168608440 CCCCCAGGTGCTCCCCGTGTGGG - Intronic
1019565893 7:1678901-1678923 AGCACGGGTGATGCCAGAGTGGG + Intergenic
1033660125 7:143397168-143397190 CCCACATGTGCCCCCAGAGTTGG + Intronic
1035231372 7:157468051-157468073 CCCACGGCTGCTCCTTGCGTGGG + Intergenic
1035873661 8:3163713-3163735 CCCACAGCTGCTTCCTGAGTGGG - Intronic
1036702631 8:11023228-11023250 CCCAGGGCTGCTCCCAGAGCAGG + Intronic
1037767671 8:21782057-21782079 CCCAGGGCTGATCCCAGAGCTGG - Intronic
1037829506 8:22179412-22179434 CCCACTGGTGCTCCCAGCTCAGG - Intronic
1038704102 8:29878107-29878129 CCCACAGTTGCTCCCTGAGAAGG + Intergenic
1044667158 8:94642159-94642181 CCCACGCGTGTTCCCGGAGCAGG + Intronic
1044997441 8:97850403-97850425 CCCACAGGAGCTCCAAGACTGGG + Intronic
1045036212 8:98178416-98178438 CACATGGGTGCTCCCACAATGGG - Intergenic
1046497758 8:115036791-115036813 CCCAGGGCCGCTCCCAGTGTGGG - Intergenic
1048214389 8:132481283-132481305 CCCACGGGAGCTCCAGGAGCCGG - Intergenic
1052855539 9:33404120-33404142 CCCATGTGTGCTCCCAGGGCCGG + Intergenic
1054870631 9:70044510-70044532 CCCCCTGGGGCTCCCCGAGTTGG + Intronic
1056683232 9:88738077-88738099 CCCATGGATGCTCCCAGACCAGG + Intergenic
1062108282 9:134767413-134767435 ACCAGGGGTCCTCCCAGGGTGGG - Intronic
1062294450 9:135816720-135816742 CCCACAGGTGCACACAGAGCAGG + Intronic
1062402083 9:136377181-136377203 CACACGTGTGCTCCCAGGGTGGG - Intronic
1062566946 9:137167713-137167735 CCCGCGCGTGCCCCCAGCGTGGG + Intronic
1203736460 Un_GL000216v2:143436-143458 CCCACTGGTGCTGCCTCAGTTGG - Intergenic
1192068233 X:67909676-67909698 CCTACTTGTCCTCCCAGAGTTGG - Intergenic
1192631479 X:72781091-72781113 CCCACGGGTGCTCCCAGAGTGGG - Intronic
1192650230 X:72939710-72939732 CCCACGGGTGCTCCCAGAGTGGG + Intronic
1195112521 X:101661499-101661521 CCCACTGATGAACCCAGAGTAGG + Intergenic
1198815072 X:140580749-140580771 CCCAGGGCTGCACACAGAGTGGG - Intergenic
1200852913 Y:7904108-7904130 GGCAGGAGTGCTCCCAGAGTGGG - Intergenic
1202039127 Y:20664521-20664543 CCCACAAGTGCTTACAGAGTGGG - Intergenic