ID: 1192632615

View in Genome Browser
Species Human (GRCh38)
Location X:72789150-72789172
Sequence GTGTGAAGAGGCAGAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192632607_1192632615 24 Left 1192632607 X:72789103-72789125 CCAGGATGACATAAAGAAGGGCT 0: 2
1: 0
2: 1
3: 10
4: 121
Right 1192632615 X:72789150-72789172 GTGTGAAGAGGCAGAATTGTGGG 0: 2
1: 0
2: 1
3: 22
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192632615 Original CRISPR GTGTGAAGAGGCAGAATTGT GGG Intronic
900923509 1:5688908-5688930 GTGTGGAGAGGCAGCATGGGAGG + Intergenic
901092497 1:6651337-6651359 GTGGGAAGAGGCAGGATTGAGGG - Intronic
901104057 1:6741619-6741641 ATGTGAAGAGGCAGCACTGCTGG - Intergenic
901147158 1:7072982-7073004 GTGTGAAGAAGCAAGAGTGTAGG + Intronic
904037722 1:27567787-27567809 CTGTGAAGAGGGAGAGATGTTGG - Intronic
906923836 1:50092955-50092977 GTGAGAATAGGCAGAATTAATGG - Intronic
908046878 1:60179790-60179812 GTGGGCAGAGGCAGAAGTGGAGG + Intergenic
908637485 1:66184304-66184326 GTTTGAAGAAACAGAATTATAGG + Intronic
908860064 1:68474556-68474578 GTGTGAAAAAGCCTAATTGTGGG - Exonic
909460723 1:75910075-75910097 GAGTAAACAGGCAGAATTTTAGG - Intronic
912800603 1:112717494-112717516 GTATGAAGAAGCAGACTTGTGGG + Intergenic
913693531 1:121302020-121302042 GGTTGAGGAGACAGAATTGTTGG + Intronic
913989016 1:143592491-143592513 GTGTGTAGGGGCAGGATTATGGG - Intergenic
914144025 1:144978060-144978082 GGTTGAGGAGACAGAATTGTTGG - Intronic
916206423 1:162319917-162319939 GTGGGAGGTGGCAGGATTGTGGG - Intronic
916269628 1:162926720-162926742 CTGGGAAGAGATAGAATTGTTGG + Intergenic
916679412 1:167090399-167090421 GTGAGAAGAGGGAAAATTGCAGG - Exonic
917098749 1:171425450-171425472 GTGTTAAGAGACAAAATTGCAGG + Intergenic
918254809 1:182739705-182739727 GTGTGAAGAGGCAGAGGTCAAGG - Intergenic
918847676 1:189639479-189639501 ATGTGAAGAGACAGAAAAGTAGG + Intergenic
920023513 1:202974711-202974733 GTGTGAAGCAGAAGAATTGCAGG - Intergenic
920089146 1:203440127-203440149 GTGGGAAGAGGCAGTAATGAAGG + Intergenic
920382722 1:205544976-205544998 GTGTGAAGTGACAGCCTTGTGGG - Intergenic
920480855 1:206320389-206320411 GGTTGAGGAGACAGAATTGTTGG + Intronic
920706901 1:208258046-208258068 GAGTGAAAAGGCAGACTTGGAGG + Intergenic
920749682 1:208661902-208661924 GTGAAAAGAGGCAGGATTCTAGG - Intergenic
921582469 1:216911380-216911402 ATATGAAAAGGCAAAATTGTGGG + Intronic
923567666 1:235088667-235088689 CTGTGAAAAGGCAGAATCCTGGG + Intergenic
924733271 1:246731566-246731588 GTGTGAAGAAGCAGCATGCTTGG + Intronic
1063628295 10:7711676-7711698 GTGTGTTGAGGCACACTTGTGGG - Intronic
1064120632 10:12615150-12615172 GCGAGAGGAGGCAGAATTGGTGG + Intronic
1067576467 10:47411859-47411881 GGGTCAAGAGGAAGAATTGAGGG - Intergenic
1069604145 10:69729326-69729348 GTGGAAATAGGCAGAATTGAAGG + Intergenic
1070272929 10:74975590-74975612 AAGTGTAGAGGCAGAAATGTAGG - Exonic
1071768700 10:88700047-88700069 GTGTAAAGATGCAGGATTGATGG + Intergenic
1071964832 10:90842113-90842135 GTATTAAGAGGCAGACTTTTGGG + Intronic
1072162266 10:92779452-92779474 GTGTGAAGACGCAGCATTCAAGG + Intergenic
1072719751 10:97773097-97773119 GTGGGAAGAGGGGGAATTGATGG + Intergenic
1072795728 10:98353119-98353141 ATGTGAAGAGGCAGAAGTTTTGG + Intergenic
1073766553 10:106688863-106688885 CTGTGAAGCCGCAGAGTTGTGGG - Intronic
1074021714 10:109591398-109591420 CTGTAAAGAGGCAGAATTGCTGG - Intergenic
1074243067 10:111658335-111658357 GTGAGAAGAGGGAGAAGTGTGGG - Intergenic
1074657198 10:115604589-115604611 GTGTGGAGAGGCTGAGTTGTAGG - Intronic
1075617494 10:123902272-123902294 GTGGGAAGAGTCAGAATGGGAGG - Intronic
1076234204 10:128851242-128851264 GGGTGGAGGGGCAGAAATGTTGG - Intergenic
1077982203 11:7311519-7311541 TTGTGTAGACACAGAATTGTTGG + Intronic
1078370932 11:10744540-10744562 ATTTGAATAAGCAGAATTGTGGG - Intergenic
1079551639 11:21706078-21706100 ATTTGAAGAGGTAGAATTCTGGG - Intergenic
1080228322 11:29986309-29986331 TTCTGAAGAGGAAGAATTCTGGG + Intergenic
1080944046 11:36951042-36951064 GTGGGAAGAGGGAGAAGTGTGGG + Intergenic
1081185182 11:40033686-40033708 GTGTGAAAAGGAAGACTTTTAGG + Intergenic
1083134341 11:60657554-60657576 ATGTGAAAAGGCAGATTTATTGG - Intergenic
1090430925 11:126645791-126645813 GTGTGAGGAAGCAGTAATGTAGG - Intronic
1090699755 11:129282955-129282977 CTGTGATGAGGCAGACTTGGAGG - Intergenic
1092120783 12:6042306-6042328 TTGTGAAGGGGCAGGGTTGTGGG - Intronic
1093214176 12:16343835-16343857 GTATTTAGAAGCAGAATTGTTGG + Intergenic
1094551070 12:31452086-31452108 TTGTGAAGAGGCAGAACTAAGGG - Exonic
1096035886 12:48469837-48469859 GTGGGAAGAGACAGTGTTGTGGG - Intergenic
1096772068 12:53941440-53941462 GTGTGAAGAGGTAGAAGAGAAGG + Intronic
1098090320 12:66894253-66894275 CTGAGGAGAGACAGAATTGTGGG - Intergenic
1098424725 12:70349055-70349077 ATGAAAACAGGCAGAATTGTTGG + Intronic
1098990244 12:77057956-77057978 GTGTGAAGAGGTAAAATATTGGG + Intronic
1099424527 12:82505794-82505816 GTGAGAAGGTGCAGAGTTGTTGG - Intergenic
1100597040 12:96080679-96080701 TTGTGAAGATGCAGACATGTAGG + Intergenic
1102324485 12:111968226-111968248 GTGAGAACAGGCACTATTGTTGG - Intronic
1102660788 12:114526442-114526464 GAGGGAAGAGGCAGAACTGTTGG - Intergenic
1104058353 12:125247396-125247418 CTGTGAATAGGCAGAATCTTAGG - Intronic
1105799086 13:23888188-23888210 GTGTGAAGAGACCTACTTGTAGG - Intronic
1106127045 13:26909210-26909232 GTGTTGAGAGGGAGGATTGTGGG - Intergenic
1108248853 13:48544866-48544888 GAGTGAAGAGCCAGTTTTGTAGG - Intergenic
1108538006 13:51406271-51406293 GTGTCATGAGGCAGAATATTTGG - Intronic
1108912650 13:55576649-55576671 GTGTGAAGATGTGGAATTGTTGG - Intergenic
1110277982 13:73661072-73661094 GTGGGAGGAAACAGAATTGTGGG + Intergenic
1110380931 13:74849802-74849824 GTTTTAAGAGGCAAAATGGTAGG - Intergenic
1113100139 13:106708495-106708517 TAGTGAATATGCAGAATTGTTGG + Intergenic
1113210622 13:107975558-107975580 ATGTGAAGAGAGAGAATTGGAGG + Intergenic
1113348521 13:109505420-109505442 GTGTGTAGAGGAAAATTTGTAGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114310457 14:21461932-21461954 GTGTGACGAGGTAGAAGTGGAGG + Intronic
1114596718 14:23918523-23918545 ATGAGAAGAGGCTGAAGTGTGGG - Intergenic
1114862845 14:26547216-26547238 CTGTGAAAGGCCAGAATTGTGGG - Intronic
1118904768 14:70015793-70015815 TTTTGAAAAGGCAGTATTGTTGG + Intronic
1119364162 14:74077533-74077555 GTGTGAAGAGGCAAAACTGGGGG + Intronic
1119774905 14:77242314-77242336 GGGAGAAGAGGAAGAAATGTGGG - Intronic
1120840040 14:89077655-89077677 GGGTCAGCAGGCAGAATTGTTGG - Intergenic
1121953959 14:98197447-98197469 ATGTGAAGATCCAGAACTGTGGG - Intergenic
1122348505 14:101074693-101074715 GAGTGGAGAGGGAGAATTGGAGG + Intergenic
1123037583 14:105477785-105477807 GTGGGAGGAGGCAGATTTGTGGG + Intronic
1124796332 15:32784246-32784268 GGGAGAAGAGGCAGAATTAGGGG + Intronic
1125298553 15:38229586-38229608 ATGTGAAGACTCAGAATTCTTGG + Intergenic
1131700641 15:94931928-94931950 GTGTGTAGAATCAGAACTGTTGG + Intergenic
1133930179 16:10225830-10225852 GTGTCAAAATGCAGATTTGTGGG + Intergenic
1135755644 16:25095607-25095629 TTGTGAGGAGGAAGACTTGTTGG - Intergenic
1137771137 16:51015893-51015915 ATCTGAAGAGGCAGAGGTGTGGG + Intergenic
1138294462 16:55874402-55874424 GTGTGGAGTGACAGAAGTGTAGG - Intronic
1138363428 16:56451959-56451981 GTGAGAAGAGGGAGAAATGGAGG + Intronic
1139793217 16:69458295-69458317 GTGTGAGGAGGACGAGTTGTGGG - Intronic
1141000456 16:80302712-80302734 GAGGTGAGAGGCAGAATTGTGGG - Intergenic
1143001616 17:3798426-3798448 GTGTGAAGAGTCTGGTTTGTAGG - Intronic
1143244010 17:5468129-5468151 ATGAAAAGAGGCAGAGTTGTGGG - Intronic
1147313781 17:39609346-39609368 GTCTGGAGGGGCAGAAATGTGGG - Intronic
1147587963 17:41663703-41663725 GTGTGATGAGGCATATTTGGAGG + Intergenic
1148285189 17:46383367-46383389 GTGTCCAGAGGTAGAATTGCTGG + Intergenic
1148307352 17:46600963-46600985 GTGTCCAGAGGTAGAATTGCTGG + Intronic
1149428515 17:56578122-56578144 CTGTGAATGGGCAGAATGGTGGG + Intergenic
1149646370 17:58244524-58244546 GGGTGAAGAAGCAGAAGTGAAGG + Intronic
1151052180 17:70990754-70990776 GTGTTGAGAGGCAGAAATGGAGG + Intergenic
1152185281 17:78852418-78852440 GGATGAAGGGGCAGAAGTGTAGG - Intergenic
1152790300 17:82275017-82275039 GTGAGAAGAGCTAGAAATGTTGG - Intergenic
1155030134 18:21977145-21977167 TGGTGATGAGGAAGAATTGTGGG + Intergenic
1155961424 18:31998716-31998738 TAGTGAGGAGGCAGAGTTGTGGG + Intergenic
1157831129 18:50857871-50857893 GTGTGAAGGAGCAGAATCCTGGG - Intergenic
1158437686 18:57444892-57444914 GGGTCAGGAGGCAGAATTGTGGG + Intronic
1160485961 18:79292807-79292829 GAGTGCAGTGGCACAATTGTGGG + Intronic
1163723554 19:18909990-18910012 CTGTGCAGAGGCAGCATGGTGGG - Intronic
1164626284 19:29730575-29730597 TTGTGCAGAGGCAGAATTTCAGG + Intergenic
1166398720 19:42462037-42462059 GGCAGAAGAAGCAGAATTGTGGG + Intergenic
1168431460 19:56284564-56284586 GAGTGCAGTGGCACAATTGTAGG + Intronic
1168665087 19:58198940-58198962 GGGTGAAGTGGGAGAATTGCTGG + Intronic
925396422 2:3536654-3536676 GTGTGAAGAGGCATTATTCAAGG - Intronic
929555302 2:42922089-42922111 GGGTGCAGAGGCAGGATTGCAGG - Intergenic
931046360 2:58358257-58358279 GTGTGAAGATGCAGAAATTCTGG - Intergenic
934101503 2:88657488-88657510 CTGAGAAGAGGAAGAATTCTGGG + Intergenic
934702329 2:96452306-96452328 GTTTGAAGAGCGAGAAGTGTAGG - Intergenic
936686515 2:114833629-114833651 GTATTAAGAGGCAGACTTGGAGG - Intronic
937629370 2:124082662-124082684 GTGTCAAGAAGTACAATTGTTGG + Intronic
939099926 2:137884139-137884161 GTGTGTAGAGAGAGTATTGTTGG + Intergenic
939868572 2:147502743-147502765 AGGTGTAGAGGCAGAATTATTGG - Intergenic
940625418 2:156169367-156169389 GTGTAAAGAGGCATAATCGAGGG - Intergenic
941948316 2:171124842-171124864 GTTTGAAGTGGCAGAAAAGTTGG - Intronic
942136848 2:172934780-172934802 TTGTGAAGAGGGAGAATGTTGGG - Intronic
943336373 2:186620101-186620123 GTGCAAAGAGGCAGAAGAGTGGG - Intronic
944761080 2:202814363-202814385 GTGTGAAGAGGCAAAATCAAGGG - Intronic
945899855 2:215525569-215525591 GTGTGAATATGCAGGAATGTGGG - Intergenic
946605135 2:221395988-221396010 TTAGGAAGAGGAAGAATTGTGGG + Intergenic
947292253 2:228588930-228588952 GTGTCCAGAAGCAGAATTGTTGG + Intergenic
947996084 2:234529087-234529109 GTGTGAAGGGGGAAAACTGTTGG + Intergenic
948604105 2:239123771-239123793 GCGGGAAGAGGCAGCAGTGTTGG + Intronic
1169975144 20:11316847-11316869 GTGTTCAGAGGAATAATTGTAGG + Intergenic
1170164481 20:13347204-13347226 GTGAGTAGAGGCAGGAATGTGGG - Intergenic
1171058802 20:21935324-21935346 ATGTAATGAGACAGAATTGTAGG + Intergenic
1171307214 20:24116845-24116867 GGGGGAAGGGGGAGAATTGTAGG + Intergenic
1172586814 20:36091493-36091515 CAGTGAAGAACCAGAATTGTTGG + Intronic
1173220237 20:41126325-41126347 GAGTGAAGAGAAGGAATTGTGGG - Intergenic
1173692784 20:44977404-44977426 GTGTGAAGATACAGATGTGTTGG + Intronic
1174890898 20:54391264-54391286 GTGGGAATAGGCACAATTTTGGG - Intergenic
1175878232 20:62240891-62240913 GTGTGAAGAGGGAGGACTGAGGG + Intronic
1177274892 21:18897572-18897594 GTATTAAGAGGAAAAATTGTGGG + Intergenic
1180865785 22:19118947-19118969 GTGTGATGAGGAAGAACGGTTGG - Intronic
1182770410 22:32791604-32791626 GCTTGAAGAGGCAGAGTGGTGGG + Intronic
1183258869 22:36781235-36781257 GGGTGTAGTAGCAGAATTGTTGG + Intergenic
1184283663 22:43453717-43453739 GTGTGAGCAGGCAGAATTGTAGG - Intronic
1184985298 22:48128759-48128781 GTGTGTAGAAGCAGAATTAGAGG - Intergenic
949599670 3:5584288-5584310 GTGTGAAGAAACAGAATAGGTGG + Intergenic
951052807 3:18113657-18113679 CTGTCAAGATACAGAATTGTGGG - Intronic
951813235 3:26724652-26724674 GTGTGCACAAGGAGAATTGTTGG + Intergenic
952232176 3:31443746-31443768 GTGGGAAGATGCTAAATTGTTGG - Intergenic
953843025 3:46405171-46405193 GTGTGGATAGGCAGAATGCTGGG + Intergenic
954196181 3:48998532-48998554 GAGTGAAGAGGCAGAGCTGAGGG - Intronic
955016039 3:55070310-55070332 GTGTGAAGAGAGAGAGTTGGAGG + Intronic
955518516 3:59752011-59752033 GAGTGAAGAGGCAGGAGAGTTGG + Exonic
956420631 3:69082993-69083015 ATGTCAAGAGGCAGCACTGTGGG - Intergenic
957734318 3:84187414-84187436 GTGGTAAGAGGCAATATTGTGGG + Intergenic
958169266 3:89917801-89917823 GAGTGAAGAGGCACATTGGTAGG + Intergenic
958436611 3:94104446-94104468 CTGTGATGAGGCTGAATTGAGGG + Intronic
959505682 3:107153983-107154005 GCGTGACAAGGTAGAATTGTTGG - Intergenic
959531069 3:107434007-107434029 TTGATGAGAGGCAGAATTGTGGG - Intergenic
960803619 3:121562304-121562326 GTGTGAAGAGGTAAGACTGTAGG - Intergenic
961489079 3:127240010-127240032 GTAAGATGAGGGAGAATTGTAGG - Intergenic
964413889 3:156427673-156427695 CAATGAAGAGACAGAATTGTGGG + Intronic
964800994 3:160557213-160557235 GTGTGAAGAGGAAGAACAGGTGG + Intronic
965376107 3:167926309-167926331 GTATTAAGAGGCAAAATGGTGGG + Intergenic
966723867 3:183091042-183091064 GTGGGTAGAGGGAGAATTGGAGG + Intronic
967136115 3:186514157-186514179 GTGTAAAGGGGCAGAATAATAGG + Intergenic
969288012 4:6219861-6219883 TTGTGAAGAGGCATAATCTTTGG + Intergenic
971163454 4:24157847-24157869 GAGTAGAGAGGGAGAATTGTGGG - Intergenic
971918068 4:32900314-32900336 GTGTGGATAAGCAGAATTTTGGG + Intergenic
973900653 4:55466689-55466711 GGCAGGAGAGGCAGAATTGTTGG - Intronic
974099888 4:57405057-57405079 GTGGGAAGAGGAGGAAGTGTTGG + Intergenic
975440385 4:74403770-74403792 GTGTGAACAGTGAGAATTGAGGG + Intergenic
976146794 4:82049949-82049971 CTGGGAGGAGGGAGAATTGTAGG - Intergenic
976254918 4:83089982-83090004 ATGAGAAGAGGCAAAAGTGTTGG + Intergenic
976815831 4:89148138-89148160 CTCAGAAGAGGCAGAAGTGTGGG + Intergenic
976843282 4:89457301-89457323 CTCTGAAGTGGCAGAATTGCAGG + Intergenic
977290927 4:95163469-95163491 GTGTGTAGAAGATGAATTGTAGG - Exonic
978078063 4:104558068-104558090 GCATGAAGAAGCAGAATTGGCGG + Intergenic
978650838 4:111002701-111002723 GGATGAAAAGGCAGAAGTGTGGG - Intergenic
978937242 4:114392829-114392851 CTGAGGAGAGGCAGAATTCTGGG + Intergenic
979623620 4:122823248-122823270 GTGTGCATTGGCAGAATCGTGGG - Intergenic
980763970 4:137274448-137274470 GTGGGAACAGGGACAATTGTTGG + Intergenic
982353981 4:154446703-154446725 GTCAGGAGAGGCAGCATTGTAGG - Intronic
984741950 4:183173528-183173550 GAGTGAAGAGCCAGAATGGTTGG - Intronic
985982867 5:3486929-3486951 GTGTAGAGAGACAGAAATGTGGG - Intergenic
986610358 5:9561106-9561128 GAGCGAAGAGCCAGAACTGTTGG + Intergenic
986647670 5:9933768-9933790 GTGTGAAGTGGCTGAGGTGTAGG + Intergenic
986741243 5:10707291-10707313 GTGTTGAGAGGCAGACATGTGGG + Intronic
987654775 5:20793098-20793120 ATGTGAAAAGGCAGAACTCTTGG - Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
988740867 5:34068802-34068824 ATGTGAAAAGGCAGAACTCTTGG + Intronic
988972027 5:36478356-36478378 GGGTGAAGAGGAGGAATTGAAGG + Intergenic
992003469 5:72456572-72456594 GTGTGAAGGAGCATAAGTGTGGG - Exonic
993135312 5:83953689-83953711 GTGTGAAGAGGCAGTCCTCTCGG - Intronic
993773049 5:91955516-91955538 AATTAAAGAGGCAGAATTGTAGG - Intergenic
994332534 5:98523874-98523896 TTGTGAAAAGGCAGTATTGGGGG + Intergenic
994621902 5:102173422-102173444 CAGTGAAGAAGCAGAAATGTAGG + Intergenic
994711132 5:103265469-103265491 GGGTCAAGAGGCAGAGTTCTTGG + Intronic
994851379 5:105058160-105058182 GTGGCAAGAGGCATAAGTGTGGG - Intergenic
996617654 5:125459982-125460004 GGGTGAAGAGGAAGGATTTTAGG - Intergenic
1001750807 5:174129712-174129734 GTGGGAGGAGGCAGAAATGACGG + Intronic
1001852783 5:174984123-174984145 TTGTAAAGAAGCAGCATTGTAGG - Intergenic
1003255879 6:4474522-4474544 GAGGGAAGCGGCTGAATTGTGGG - Intergenic
1003432474 6:6052756-6052778 GTGAGGAGAGGCAGAATAGATGG - Intergenic
1004209946 6:13629663-13629685 GTGTGGAGAGGCATTGTTGTAGG - Intronic
1004303253 6:14477237-14477259 GAGTGAAGAGGAGGAAATGTGGG + Intergenic
1005350420 6:24929310-24929332 GTGTCAAGAGCCTGAACTGTTGG - Intronic
1005859650 6:29890371-29890393 GTGGCTAGAGGAAGAATTGTGGG - Intergenic
1008006181 6:46411995-46412017 CTGTGAAGAGCCTGGATTGTAGG + Intronic
1008749566 6:54716107-54716129 GTGTGAAGATTGAGAAGTGTGGG - Intergenic
1009591228 6:65673330-65673352 GTGGTAAGAGGCAATATTGTGGG + Intronic
1010748589 6:79592553-79592575 GTGGGAGGAGGCAGTATTCTAGG + Intergenic
1010870969 6:81038440-81038462 GTGTTAAGAGCCAGTATTGCTGG - Intergenic
1012395054 6:98786590-98786612 GTGTAAACATGCAAAATTGTTGG + Intergenic
1013287266 6:108692370-108692392 GTTTGAAAAGGCAGAATTTTAGG - Intergenic
1013963607 6:115929296-115929318 ATGTGAAGAGGAAGAATGGGAGG + Intergenic
1014911277 6:127096443-127096465 GTGGAGAGAGACAGAATTGTCGG + Intergenic
1015921525 6:138270811-138270833 GTGGGAAGAGGCGGAATAGAGGG + Intronic
1016349582 6:143152965-143152987 GTGAGAAGAGACAGAACTGCAGG + Intronic
1018778023 6:167036336-167036358 GTGTGAAGAGACAGAATGTTGGG + Intronic
1020990644 7:15192126-15192148 TGGAGAAGAGGCAGAAGTGTGGG + Intergenic
1021248786 7:18297817-18297839 TTGTGAAGATGAAGAAATGTAGG - Intronic
1021401729 7:20217517-20217539 GGGTGAGGAGCCTGAATTGTGGG - Intergenic
1024504030 7:50146132-50146154 GTCTGAAAAGGCAGAAGTATTGG - Intronic
1027252151 7:76405763-76405785 GTGTGAAGAGGGCAAATGGTGGG + Intronic
1028916567 7:96266003-96266025 GTGTGAAGAGGTAGAACTTTGGG - Intronic
1032315878 7:130837990-130838012 GTGTGAAGTTGCTGAATCGTAGG + Intergenic
1033134532 7:138773672-138773694 GTGTCAAAAGGCACAAATGTGGG - Intronic
1034690531 7:153010240-153010262 GTGTGAAGAGGCTGATTTTATGG - Intergenic
1034787992 7:153942795-153942817 CAGGGAAGAGGCAGAATGGTAGG - Intronic
1034863221 7:154618046-154618068 GTGTGAGCAGACAGCATTGTGGG - Intronic
1036664829 8:10731251-10731273 GTGAGAAGAGCCAGAAGTGAGGG - Intronic
1040040024 8:42906350-42906372 GTGTGTAGAGTAAGAGTTGTAGG + Intronic
1040759699 8:50824497-50824519 ATGTGAAGAGCCATAATTGATGG + Intergenic
1041131060 8:54700966-54700988 GTGTGAAGAGGAAAAGTCGTTGG - Intergenic
1042907784 8:73790253-73790275 GTGGGAAGAGGCAGAAAAATAGG + Intronic
1049116123 8:140689232-140689254 GAATGAAGAGGCAGCTTTGTGGG + Intronic
1049435265 8:142583509-142583531 GTGGGATGAGGCAGAAGTGGGGG + Intergenic
1049631922 8:143663471-143663493 GTGTGATGAGCCAGAGTGGTGGG - Intergenic
1050038428 9:1462259-1462281 GTGTGAAGAGACAGTCTTCTTGG + Intergenic
1051711046 9:19931417-19931439 GTGTGATCAGAAAGAATTGTGGG - Intergenic
1052554279 9:29993696-29993718 AAGTGAAGAGGGAGAACTGTAGG + Intergenic
1053360892 9:37486070-37486092 GTGCGAGGTGGCAGTATTGTGGG + Exonic
1053549946 9:39067328-39067350 GTGTGAAGAGGCAGAAAAATAGG - Intergenic
1053814058 9:41887421-41887443 GTGTGAAGAGGCAGAAAAATAGG - Intergenic
1054616538 9:67300019-67300041 GTGTGAAGAGGCAGAAAAATAGG + Intergenic
1054817313 9:69487533-69487555 GTGTTGAGAGGCAGAACTTTTGG + Intronic
1055008875 9:71541019-71541041 CTGTGAAGAGGTGAAATTGTGGG + Intergenic
1055312491 9:74997471-74997493 GTTTGATGAGGCAAACTTGTTGG - Intronic
1056962923 9:91142494-91142516 GTGTGAATGGTCAGACTTGTAGG - Intergenic
1057209933 9:93195071-93195093 GGATGAAGAGGCAGATTTGTGGG + Intronic
1059938673 9:119336755-119336777 GTATGCAGAGGGTGAATTGTGGG + Intronic
1061273448 9:129556939-129556961 GGGTGAAAAGGCAAAACTGTCGG + Intergenic
1061329004 9:129880539-129880561 GTGTAAAGAGGCAGAAAAGTTGG + Exonic
1185588410 X:1257565-1257587 CTGTGTAGAAGCAGAATTGGTGG - Intergenic
1186305049 X:8247342-8247364 CTGTGAAGATACAGAATTGCAGG + Intergenic
1186391783 X:9167826-9167848 CTGGGAAAAGGCAGAATTGAAGG + Intergenic
1186720388 X:12297502-12297524 GTGGGAAAAAACAGAATTGTGGG + Intronic
1187485920 X:19703267-19703289 GTGTGAAGAGAAAGAGTTGGTGG + Intronic
1187493424 X:19774066-19774088 GCTTGAAAAGGCAGAATTCTGGG + Intronic
1187964576 X:24597789-24597811 GGGAGAAGAGGCAAAGTTGTTGG - Intronic
1190881863 X:54497030-54497052 GGTTGGAGAGGCAGAATTCTTGG - Intergenic
1191858034 X:65643354-65643376 GTGTCTAGAGGAAGATTTGTAGG + Intronic
1191950247 X:66583213-66583235 GTGTTAAGAGGGAAATTTGTAGG + Intergenic
1192632615 X:72789150-72789172 GTGTGAAGAGGCAGAATTGTGGG + Intronic
1192649094 X:72931651-72931673 GTGTGAAGAGGCAGAATTGTGGG - Intronic
1194955686 X:100177290-100177312 ATATGAAGAGGAAGAATTTTGGG + Intergenic