ID: 1192634396

View in Genome Browser
Species Human (GRCh38)
Location X:72804114-72804136
Sequence TGCTGGTGTCCTACAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 2, 1: 0, 2: 0, 3: 28, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192634396_1192634400 7 Left 1192634396 X:72804114-72804136 CCATCTTCTGTAGGACACCAGCA 0: 2
1: 0
2: 0
3: 28
4: 316
Right 1192634400 X:72804144-72804166 GACTGTTCTCAGGAGTACTCTGG 0: 2
1: 0
2: 1
3: 10
4: 98
1192634396_1192634398 -3 Left 1192634396 X:72804114-72804136 CCATCTTCTGTAGGACACCAGCA 0: 2
1: 0
2: 0
3: 28
4: 316
Right 1192634398 X:72804134-72804156 GCAGTCTTCCGACTGTTCTCAGG 0: 2
1: 0
2: 0
3: 7
4: 83
1192634396_1192634401 29 Left 1192634396 X:72804114-72804136 CCATCTTCTGTAGGACACCAGCA 0: 2
1: 0
2: 0
3: 28
4: 316
Right 1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG 0: 2
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192634396 Original CRISPR TGCTGGTGTCCTACAGAAGA TGG (reversed) Intronic
900877322 1:5352356-5352378 TGCTTGGGTCATAAAGAAGAAGG + Intergenic
901803005 1:11719966-11719988 TGCTGGAGTCGGACAGTAGAGGG - Exonic
902101910 1:13997101-13997123 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
909320778 1:74282849-74282871 TGGTGGTCTCCTACAGAAACAGG - Intronic
911502163 1:98700859-98700881 TTCTGGTGTTTTAAAGAAGAAGG - Intronic
911508640 1:98784607-98784629 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
913541066 1:119821872-119821894 TGCAGATGCCCTACAGAAGAGGG - Intergenic
914400706 1:147317198-147317220 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
915639697 1:157215358-157215380 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
915674915 1:157520672-157520694 GGCTGGTGTGGCACAGAAGATGG + Intronic
917582269 1:176391312-176391334 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
917872474 1:179254361-179254383 TGCAGGCCGCCTACAGAAGATGG + Intergenic
918156315 1:181849973-181849995 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
918243118 1:182637356-182637378 TGCTGGTCTGCTACAGATGAAGG - Intergenic
918302890 1:183220140-183220162 TGCTGGAGTCACAGAGAAGAAGG - Intronic
920946879 1:210537546-210537568 TGCAGCTGACCTGCAGAAGACGG - Intronic
921193097 1:212726894-212726916 TGCTGGTGTCCATCAGAGGGAGG - Intronic
921412453 1:214850272-214850294 TGCTGGTGCCCTCTAGAAGATGG + Intergenic
921915934 1:220610710-220610732 TGTTGGTGACCTACAGATGGGGG + Intronic
923654792 1:235906214-235906236 TGCAGGTGACCTTCAGAAGCTGG + Intergenic
1063407159 10:5807584-5807606 TGCTAGTGTCATACAGAACTTGG - Intronic
1063960820 10:11304204-11304226 AGCTGGTGGCCTGCAGAAGCCGG - Intronic
1064419883 10:15181610-15181632 TGCTGGTATCCTCCTCAAGAAGG + Intergenic
1065846928 10:29752370-29752392 TGTTGGTGTCCATCTGAAGAAGG + Intergenic
1066342339 10:34548113-34548135 TGCCTGTGACCTACAGAAAATGG - Intronic
1067036522 10:42924684-42924706 AGCTGGTGTCCTTCTGAAAAGGG - Intergenic
1067526682 10:47043484-47043506 TGCAGGTGTCCCAGGGAAGAGGG - Intergenic
1068126776 10:52850869-52850891 TGCAGTGGCCCTACAGAAGAAGG - Intergenic
1068358921 10:55950336-55950358 TGCTGGTGCCCTGCAGACGCTGG + Intergenic
1070483200 10:76905384-76905406 AGCTGGTGGCTTTCAGAAGAAGG + Intronic
1073725577 10:106226589-106226611 AGTTGGTCTCCTACAGAACAAGG + Intergenic
1074611146 10:115023289-115023311 TTCTGGCTTCCTCCAGAAGAGGG - Intergenic
1074732049 10:116389505-116389527 TGCTTGTATCCTGCAGAAGCTGG - Intergenic
1075021598 10:118956443-118956465 TGCTGGGGACCTCCAGGAGATGG + Intergenic
1075172271 10:120127237-120127259 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1076185237 10:128441261-128441283 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1077028989 11:455126-455148 TGCTGGTCTCTTGCAGAACAGGG + Intronic
1078146804 11:8727207-8727229 TGATGGTGCCCCAAAGAAGAGGG - Intronic
1079308462 11:19344954-19344976 TGCGTCTGTCCCACAGAAGAAGG + Intergenic
1079641717 11:22813934-22813956 TGCAGGTGGCCTCTAGAAGATGG - Intronic
1081141072 11:39501132-39501154 TGCTGGTGTTCTGCAGAACAAGG - Intergenic
1081166151 11:39810838-39810860 TGCAGGAGACCTGCAGAAGAGGG + Intergenic
1081721295 11:45290707-45290729 TGCTGGTGGACTAAAGAGGAAGG + Intergenic
1083369289 11:62165707-62165729 TGGAGGTCTCCTACAGAAGTAGG - Intergenic
1083373722 11:62202909-62202931 TGATGTTGTCATACAGAAGCAGG + Intergenic
1084443336 11:69188697-69188719 TGCTGGTGGCCTCCAGAAGCTGG + Intergenic
1084717541 11:70883395-70883417 TGTTGGTTTCCTACAGATGGAGG - Intronic
1085237213 11:75024307-75024329 GTGTGGTGCCCTACAGAAGAAGG - Intergenic
1085335067 11:75687382-75687404 TGCTGCAGACCTGCAGAAGAGGG - Intergenic
1086456345 11:86962392-86962414 TGCAGGTGACCTGCAGAAGCTGG - Intergenic
1086513930 11:87589839-87589861 TGCAGCAGTCCTACAGGAGAGGG + Intergenic
1088084347 11:105959864-105959886 TGCAGCAGCCCTACAGAAGAGGG - Intronic
1088167517 11:106956533-106956555 TGCAGCAGTCCTACAGAAGAGGG - Intronic
1088383285 11:109220947-109220969 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1092426369 12:8378870-8378892 TGGAGGTGTCCTAAAGAAGCAGG + Intergenic
1092443068 12:8526945-8526967 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1093383249 12:18520998-18521020 TGCAGCAGCCCTACAGAAGAGGG - Intronic
1093522601 12:20067644-20067666 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1094054731 12:26257041-26257063 TGCAGCAGCCCTACAGAAGACGG + Intronic
1094275432 12:28669311-28669333 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1095155262 12:38845193-38845215 TGGTTGTGTCTTACAGAAGCTGG - Intronic
1097529429 12:60780413-60780435 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1098201728 12:68063729-68063751 TGCGGCAGCCCTACAGAAGAGGG - Intergenic
1099684212 12:85865454-85865476 TGCAGCAGCCCTACAGAAGAAGG - Intergenic
1099793163 12:87362921-87362943 TGCAGCAGACCTACAGAAGAGGG - Intergenic
1100969298 12:100050441-100050463 TACTTGTGACCTACAGAACACGG + Intronic
1101345979 12:103886450-103886472 TGCTGGTTTCCATCAGAAGTAGG - Intergenic
1102366224 12:112338147-112338169 TGCTGTTGGCCAACAGAAGCTGG - Intronic
1102797029 12:115697701-115697723 TGCTTTTGTCCCACAGAAGCTGG + Intergenic
1104280678 12:127373822-127373844 TGCTGGTGTGCCACTGAAGAAGG + Intergenic
1104392410 12:128402134-128402156 TGCAGGTGACCTCCAGAAAATGG + Intronic
1106507163 13:30381166-30381188 TGCTGGTCTCCTACCTCAGATGG + Intergenic
1106890032 13:34235479-34235501 CGCTGCAGCCCTACAGAAGAGGG - Intergenic
1108160505 13:47633204-47633226 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1108932840 13:55850849-55850871 TGTAGGTGTCCTACAAAATATGG + Intergenic
1110567035 13:76967532-76967554 TGCGGCAGCCCTACAGAAGAGGG - Intergenic
1110790391 13:79581437-79581459 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1111305752 13:86410252-86410274 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1111874166 13:93872570-93872592 TGCTGATGTCCTCCAGCAGCTGG - Intronic
1113254066 13:108487280-108487302 TGCAAGTGACCTACAGAAGAAGG + Intergenic
1115349442 14:32377699-32377721 TTCTGGTGTTCTCCAGAAGTAGG - Intronic
1117640609 14:57794930-57794952 TGCTGGTGGAATTCAGAAGATGG + Intronic
1118523607 14:66616465-66616487 TGCAGTGGCCCTACAGAAGAGGG - Intronic
1118926903 14:70199531-70199553 TGCAGCAGACCTACAGAAGAGGG - Intergenic
1120320003 14:82947401-82947423 TCCTGGTGTTCTCCAGAAGGAGG + Intergenic
1121706901 14:96002845-96002867 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1121958664 14:98238417-98238439 TGCTGGTGTCCTCTAGTAGCTGG - Intergenic
1123839604 15:24234680-24234702 TGCTGGCTTCCTAAAGTAGATGG - Intergenic
1126284487 15:46996055-46996077 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1127042458 15:54991472-54991494 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1127421949 15:58814989-58815011 TTTTGGTGTCCTACCTAAGAGGG + Intronic
1127635856 15:60869079-60869101 TGGTGGTATCCTTCAGAAAATGG + Intronic
1128309347 15:66620818-66620840 TGCTGGTAACCTGGAGAAGAAGG + Intronic
1128841714 15:70855652-70855674 TTCTAGTGTCCTTAAGAAGAGGG - Intronic
1129086825 15:73102714-73102736 TGTTGGTGTTCTACAGAATTTGG + Intronic
1129394473 15:75236440-75236462 CGCTGGTGTCCCACAGAGGCAGG + Intergenic
1131078552 15:89514783-89514805 AGCTGTTCTCCTACAGAACAAGG + Intergenic
1131079863 15:89525857-89525879 TGCAGGTGGCCTCTAGAAGAGGG + Intergenic
1131427646 15:92360050-92360072 CCCTGATGTCCTACAGAAGCTGG + Intergenic
1134870090 16:17644776-17644798 TGCTGGTGCCCTCTAGAAGCTGG + Intergenic
1135198873 16:20419381-20419403 TGCTGGTGTCAGACAGCAGTCGG + Exonic
1135219814 16:20604294-20604316 TGCTGGTGTCAGACAGCAGTCGG - Intergenic
1139557401 16:67721111-67721133 TGCTGGTGTCCACCTGAAGGTGG - Intergenic
1139957715 16:70701024-70701046 TCCTGGTGTCCCAGAGAAGCTGG + Intronic
1143231504 17:5359425-5359447 TGCTGCTGTGATACTGAAGAGGG - Intronic
1144515836 17:15917312-15917334 CGCTGGTGTCCTCTTGAAGAGGG + Intergenic
1144905561 17:18637824-18637846 TGCAGGGGTCCCAGAGAAGATGG - Intronic
1145826258 17:27879406-27879428 TGCTGCTGAGCTCCAGAAGAGGG + Exonic
1149377841 17:56063994-56064016 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1149571876 17:57677864-57677886 TGCTGGTGTTCTTCCCAAGAAGG - Intronic
1150196405 17:63304331-63304353 TGCAGCAGCCCTACAGAAGAGGG - Intronic
1150307241 17:64096071-64096093 TTTTGGGGTCCTACAGAACAGGG + Intronic
1153621052 18:6978202-6978224 TGGTGGAGTCCTGCAGAAGCTGG + Exonic
1153904940 18:9652920-9652942 TGCAGGTGGCCTCCAGAAGAAGG - Intergenic
1154304895 18:13223468-13223490 TGCTGGGATTCTTCAGAAGAGGG + Intronic
1156529889 18:37805474-37805496 TGCAGCAGTCCTACAGAAGAGGG - Intergenic
1157719084 18:49909706-49909728 TGCTGCTGGCCCATAGAAGATGG + Intronic
1157853632 18:51083190-51083212 TGCTGGTGTCCTCCAGACAACGG - Exonic
1158222788 18:55167387-55167409 TGCAGGTGACCTCCAGAAGATGG - Intergenic
1159775975 18:72603015-72603037 TGCTGGTTTTTTACAGATGATGG - Intronic
1162182606 19:8880322-8880344 TGCAGCAGCCCTACAGAAGAGGG + Intronic
1163872269 19:19831580-19831602 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1163886033 19:19965835-19965857 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1163888435 19:19989642-19989664 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1163958268 19:20664095-20664117 TGCAGCAGCCCTACAGAAGAGGG - Intronic
1165990638 19:39810590-39810612 TGCAGGTGTCATGCTGAAGATGG - Intergenic
1166904823 19:46100968-46100990 TGCAGCAGTCCTACAGAAGAGGG - Intergenic
1167206195 19:48104204-48104226 TGCTGGTGTATTACAAAAGATGG - Intronic
1168225759 19:54993849-54993871 TGCAGGTGGCCAACAGAAGTTGG - Intronic
1168236008 19:55063560-55063582 TCCTGGGGTCCTGCAGGAGAAGG + Intronic
925111592 2:1342727-1342749 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111631 2:1342955-1342977 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111711 2:1343410-1343432 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111750 2:1343637-1343659 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111769 2:1343750-1343772 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111787 2:1343863-1343885 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111806 2:1343976-1343998 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111845 2:1344203-1344225 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111883 2:1344429-1344451 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111901 2:1344542-1344564 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111920 2:1344655-1344677 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111979 2:1344996-1345018 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925112017 2:1345223-1345245 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925112037 2:1345336-1345358 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925112118 2:1345790-1345812 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925112138 2:1345903-1345925 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925239958 2:2316347-2316369 TTCTGGTCTCCTAGAGCAGAAGG - Intronic
925447396 2:3940136-3940158 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
925491590 2:4401055-4401077 TGCTGGTGACCGGCAGAAGCTGG + Intergenic
927711199 2:25327458-25327480 TGCTGGTGAGCTCCAGAAGCAGG - Intronic
928488380 2:31755235-31755257 TGCAGCAGGCCTACAGAAGAGGG + Intergenic
928803805 2:35126075-35126097 TGCAGCAGCCCTACAGAAGAAGG + Intergenic
930545874 2:52766389-52766411 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
930552367 2:52852120-52852142 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
930612827 2:53562489-53562511 TGCTTTTGTGCTGCAGAAGAGGG - Intronic
931175179 2:59847293-59847315 TGCTGCTGCCCTACAGAAAAAGG + Intergenic
931560532 2:63555740-63555762 TGCAGCAGCCCTACAGAAGAGGG + Intronic
933129598 2:78655707-78655729 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
933796022 2:85920377-85920399 TGCTCGTGCCCTAGGGAAGATGG - Intergenic
934576575 2:95405560-95405582 TGCTGGTGTCTGGTAGAAGAAGG + Exonic
934584127 2:95474755-95474777 TGCTGGTCTCAGACAGAACAGGG + Intergenic
934595325 2:95601959-95601981 TGCTGGTCTCAGACAGAACAGGG - Intergenic
936848984 2:116873464-116873486 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
937004425 2:118498185-118498207 AGCTGGTGACCCACAGATGAAGG - Intergenic
937931612 2:127209246-127209268 TGCAGCAGCCCTACAGAAGAGGG + Intronic
938608091 2:132917374-132917396 TTCTGATGTTATACAGAAGAGGG + Intronic
938949435 2:136243397-136243419 CACTGGAGACCTACAGAAGAAGG + Intergenic
939109815 2:137992929-137992951 TGCAGCAGCCCTACAGAAGAGGG + Intronic
939809074 2:146808758-146808780 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
941171475 2:162142554-162142576 TGCTGGGGCCCTACACAAGCTGG + Intergenic
942497085 2:176551149-176551171 AAGTGGTGTCCTAAAGAAGAGGG - Intergenic
945164419 2:206927285-206927307 TGCAGCAGACCTACAGAAGAGGG + Intergenic
946180132 2:217943969-217943991 AGCTGGTTTCCCCCAGAAGAAGG + Exonic
946546512 2:220749751-220749773 TGCAGGAGCCCTACAGAAGAGGG + Intergenic
947098230 2:226591300-226591322 TGCAGCAGTCCTACAGTAGAGGG - Intergenic
1169146770 20:3257850-3257872 AGGTGGTGTCCTACAGTAGGTGG + Intronic
1169313519 20:4568678-4568700 TGATGTTGTCCTACAGAGGAAGG - Intergenic
1170085508 20:12526953-12526975 TTTTGGTGTCCTCCAGAAAAGGG + Intergenic
1171467408 20:25339734-25339756 TGCAGTTGTCTCACAGAAGACGG - Intronic
1172850316 20:37957528-37957550 AGCTGCTGACCTACTGAAGACGG + Intergenic
1173149477 20:40553647-40553669 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1173680976 20:44881601-44881623 GGCTGGTGCCCTAAAGAAGGAGG - Intergenic
1173889711 20:46496833-46496855 TGTGGGTGTCCTACAGAGGTTGG - Intergenic
1173908336 20:46645095-46645117 TGCAGGTGGCCTCCAGAAGCTGG - Intronic
1175905933 20:62379449-62379471 TGCTGTTTTCCTACTGAAAATGG - Intergenic
1177643246 21:23870903-23870925 TTCTGGTGTTCCACGGAAGAAGG + Intergenic
1179560823 21:42215135-42215157 TGTTGGGGTCCTGCAGAAGATGG + Intronic
1183024079 22:35050563-35050585 AGCTGTTTTCCTAGAGAAGATGG + Intergenic
949592810 3:5511096-5511118 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
949632482 3:5943710-5943732 TGATGGTGACCTACAGATGTGGG + Intergenic
952823561 3:37506109-37506131 AGCTGGGGTCAGACAGAAGAGGG + Intronic
954757510 3:52849500-52849522 TGCTGGTGTCTTCCATTAGAAGG + Intronic
954762421 3:52885934-52885956 TTCTGGTTGCTTACAGAAGATGG + Intronic
956157811 3:66317356-66317378 TGCAGTAGTCCTACAGAAGAGGG - Intronic
956293701 3:67689359-67689381 TGTTGGTGTCCTCTAGAAGCTGG - Intergenic
957344463 3:78944061-78944083 TGTTGTTGTAATACAGAAGATGG - Intronic
957584235 3:82114128-82114150 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
957629989 3:82706654-82706676 AGCAGGAGCCCTACAGAAGAGGG - Intergenic
958656387 3:97008879-97008901 TGCAGTAGCCCTACAGAAGAGGG - Intronic
959030989 3:101299650-101299672 TGCAGCAGCCCTACAGAAGAGGG - Intronic
959452813 3:106523755-106523777 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
962692043 3:137908170-137908192 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
963590115 3:147246792-147246814 TGCTGGGGACCTCCAGTAGAAGG - Intergenic
964007659 3:151851520-151851542 TGCAGTAGCCCTACAGAAGAGGG - Intergenic
964161298 3:153648631-153648653 TGCTGATCTCCCACAGGAGATGG + Intergenic
965321164 3:167252636-167252658 TGCTGATGTCCAACAGCAGAAGG - Intronic
965385022 3:168035519-168035541 TGTTGGTTTGCTACAGATGATGG - Intronic
965498069 3:169422789-169422811 TGCTGGTGAGCCACAGAAGTTGG - Intronic
965873569 3:173289415-173289437 TGCTGGTAGCCTGCAGAAGCTGG - Intergenic
966250406 3:177859698-177859720 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
966539532 3:181074609-181074631 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
967794700 3:193587314-193587336 TGCTGGTAGCCACCAGAAGATGG - Intronic
967958048 3:194893437-194893459 TTCTGATGTCCAACAGAGGAAGG - Intergenic
968692217 4:1998026-1998048 TGCAGCAGCCCTACAGAAGAGGG + Intronic
970448892 4:16147980-16148002 TGCAGGTGTCCTCCAGGAGTGGG + Intergenic
971147508 4:23994995-23995017 TGATGGTGTCCTACCTAAGTTGG + Intergenic
972460114 4:39293910-39293932 TGCAGGTGGCCTCCAGAAGCTGG - Intronic
973018604 4:45172221-45172243 TGCAGCAGTCCTACAGAAGAGGG - Intergenic
973266677 4:48218330-48218352 TGTTGTTGTTATACAGAAGATGG + Intronic
973576352 4:52293591-52293613 GGCAGGTGTCCCTCAGAAGAAGG - Intergenic
974378837 4:61111563-61111585 TGAGGGTGGCCTGCAGAAGATGG + Intergenic
974449340 4:62031589-62031611 CCATTGTGTCCTACAGAAGAAGG + Exonic
974760480 4:66267181-66267203 TGCAGCAGACCTACAGAAGACGG + Intergenic
974768763 4:66383421-66383443 TGCTGCAGCCCTACAGAAGAGGG + Intergenic
974946516 4:68535640-68535662 TGCAGGAGACCTGCAGAAGAGGG - Intergenic
976538105 4:86242103-86242125 TGCAGGAGCCCTATAGAAGAGGG - Intronic
976807318 4:89063027-89063049 TGCAGCAGCCCTACAGAAGAGGG - Intronic
978206262 4:106083827-106083849 TGCAGCAGCCCTACAGAAGAGGG + Intronic
978656937 4:111075433-111075455 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
979775543 4:124583954-124583976 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
980392821 4:132169148-132169170 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
981882228 4:149627950-149627972 TGCAGGTGGCCTCCAGAAGCTGG + Intergenic
982371696 4:154640325-154640347 TGCTGCTGCCCTTCATAAGATGG + Intronic
985829424 5:2217165-2217187 TTCAGGTGTCCTTCAGAGGATGG + Intergenic
986492525 5:8307204-8307226 TGCAGCAGCCCTACAGAAGACGG + Intergenic
987910707 5:24140639-24140661 TACGGGTATCCTACAGAACAAGG - Intronic
987988485 5:25180716-25180738 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
989676578 5:43980992-43981014 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
990655360 5:57949279-57949301 TGCTGCTGTTGTACAGTAGACGG - Intergenic
990998417 5:61757157-61757179 TGCTGATGCCATGCAGAAGATGG - Intergenic
992085332 5:73273246-73273268 TGCAGGGGGGCTACAGAAGATGG - Intergenic
992217529 5:74540640-74540662 TGCTAGTGTCCTCCAGTGGAGGG - Intergenic
993145150 5:84085431-84085453 TGCAGCTGACCTGCAGAAGAAGG - Intronic
993253458 5:85556893-85556915 TGCAGCTGCCCTACAGAAGAGGG + Intergenic
993589686 5:89778625-89778647 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
993819977 5:92602194-92602216 GGCTGTTGTCCTACAAAAAAGGG + Intergenic
994201672 5:96983785-96983807 TGTTGGTGTGCTACAGAAAGAGG + Intronic
994275912 5:97837069-97837091 TGCAGGTGTCCTCTAGAAGCTGG - Intergenic
994344621 5:98669486-98669508 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
995003111 5:107158644-107158666 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
995052324 5:107720121-107720143 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
995340862 5:111057679-111057701 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
995594101 5:113730476-113730498 TGCAGCAGTCCTGCAGAAGAGGG - Intergenic
996893938 5:128456684-128456706 TGCAGCAGCCCTACAGAAGAAGG + Intronic
997238124 5:132287076-132287098 TGCTGGTGTCCTAGAAAACCTGG + Intronic
999432146 5:151533571-151533593 TGCTGGTGTCAAACAGAGCAGGG + Intronic
1000143002 5:158424838-158424860 TGGAGGAGGCCTACAGAAGATGG + Intergenic
1001764367 5:174233684-174233706 TGGTGGTGTGTTTCAGAAGATGG + Intronic
1002633113 5:180594037-180594059 TGCTGGGGACCCACAGATGACGG - Intergenic
1003838557 6:10096685-10096707 TGCTGTTTACCTACAGAGGAAGG + Intronic
1004410325 6:15375569-15375591 TGCTGGAGACCCACAGAACAAGG - Intronic
1005440838 6:25866110-25866132 TGCTTGTATCCAACAGAATACGG + Intronic
1005979985 6:30829329-30829351 TGCAGGTGCCCTAGAGAACATGG - Intergenic
1007797473 6:44361815-44361837 TTCTGGTGTATTGCAGAAGATGG + Exonic
1008741660 6:54615660-54615682 TGCAGCAGGCCTACAGAAGAGGG + Intergenic
1008773545 6:55008642-55008664 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1009794954 6:68455447-68455469 TGTTGGTGACCTTCAGATGAAGG + Intergenic
1011131447 6:84055812-84055834 TGCTGCTGTGTTACAAAAGAAGG - Intronic
1011377541 6:86706367-86706389 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1013461627 6:110379466-110379488 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1014084875 6:117330715-117330737 TGCAGCAGCCCTACAGAAGAGGG + Intronic
1014864126 6:126506449-126506471 TGCAGTAGCCCTACAGAAGAGGG + Intergenic
1015358292 6:132305747-132305769 TGCAGCAGCCCTACAGAAGAGGG + Intronic
1015883780 6:137895561-137895583 AGCTGGTCACCTGCAGAAGAAGG - Intergenic
1016879911 6:148900877-148900899 TGCTGGTGGCCTCTAGAAGCTGG - Intronic
1016910071 6:149190140-149190162 TGCTGGTATCCACCTGAAGATGG - Intergenic
1018805903 6:167259182-167259204 TGCAGCAGACCTACAGAAGAGGG + Intergenic
1019984871 7:4648288-4648310 TGCTGCTCTCCTGCAGAAGCAGG - Intergenic
1020525368 7:9251712-9251734 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1021170846 7:17396524-17396546 GGTTTGTGTCCTACAGAGGAAGG - Intergenic
1021503999 7:21360840-21360862 TGCTGGTGTCCTGCTGCAGAGGG + Intergenic
1023363593 7:39440943-39440965 TGCAGCAGCCCTACAGAAGAGGG - Intronic
1024118579 7:46215293-46215315 GGCTGGTGTCCTGCAGGAAAGGG - Intergenic
1024402068 7:48935843-48935865 TGGTGGTCTCCTGCAGAAGTTGG + Intergenic
1027866809 7:83658712-83658734 TGTGGGTGTCCTGCAGAAGCTGG - Intergenic
1027944143 7:84723481-84723503 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1028644257 7:93077257-93077279 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1029039595 7:97558412-97558434 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1030413522 7:109212613-109212635 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1031919450 7:127590116-127590138 TGCTGATGAACTCCAGAAGATGG + Exonic
1033274331 7:139959845-139959867 TGCTGGTGTCCCAGAGCTGAGGG + Intronic
1038423097 8:27446116-27446138 AGCTGGTGTCCTCCAGAGCAGGG - Intronic
1039464603 8:37775503-37775525 TGCTCGTGTGCTAAAGAAGCAGG + Intronic
1039582461 8:38678113-38678135 TGCTGGTGACTTTCAGAAGGGGG + Intergenic
1039685819 8:39801267-39801289 TGCAGCAGCCCTACAGAAGAGGG - Intronic
1040614086 8:49017799-49017821 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1041021827 8:53645622-53645644 AGCTGGTGTCCTAAAGAAGCAGG - Intergenic
1042630059 8:70806153-70806175 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1042694239 8:71538996-71539018 TGATGGTGCCCTCCAGAGGAGGG + Intronic
1043543957 8:81294614-81294636 GGCTGGGGACCTGCAGAAGAAGG - Intergenic
1044135787 8:88584295-88584317 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1044266341 8:90186099-90186121 TGCTGATGTCCAAGAGCAGAAGG - Intergenic
1044356042 8:91224436-91224458 TGCAGCAGCCCTACAGAAGAGGG - Intronic
1044512675 8:93100884-93100906 TGCTGCTGGGCTACAGAAGCAGG - Intergenic
1045344745 8:101283895-101283917 GACTGGTGTCCTAAAAAAGAGGG - Intergenic
1045648769 8:104324107-104324129 TGCTGGTGTTCTGCAGGAGGAGG + Intergenic
1046933785 8:119867250-119867272 TGTAGGTCTCCTACAGAAAAAGG - Intergenic
1047906290 8:129476529-129476551 TGGTGGTGTCCTAAGGAAGGGGG + Intergenic
1048075249 8:131062788-131062810 TGCTTGTGCCCTGCAGAAGAAGG - Intergenic
1049219671 8:141423255-141423277 GCCAGGTGCCCTACAGAAGATGG + Intronic
1050982428 9:12036688-12036710 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1052225181 9:26077392-26077414 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1052369348 9:27646063-27646085 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1052420896 9:28241861-28241883 TGCAGCAGCCCTACAGAAGAGGG + Intronic
1053416928 9:37952705-37952727 TGCTGGTGTCCGGCAAAAAAAGG + Intronic
1054855899 9:69899362-69899384 TGGTGGTGGGCTCCAGAAGAAGG - Intronic
1055798262 9:80000335-80000357 TGCTGGTGCCATGTAGAAGAGGG + Intergenic
1056700977 9:88907938-88907960 TGATGGTGACCTACAGATGGGGG - Intergenic
1058068182 9:100572813-100572835 TGCCCGTATCCTAAAGAAGAAGG - Intronic
1060483166 9:124029900-124029922 TCCTGGTGGCCTAAAGAAAATGG - Intronic
1185846173 X:3440470-3440492 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1186201239 X:7157319-7157341 TCCTGGAGTCCCACAGAAGAAGG - Intergenic
1186431041 X:9504182-9504204 TGCAGCAGCCCTACAGAAGAGGG + Intronic
1187118194 X:16375174-16375196 TGCTGGTGCCCTCTAGAAGCTGG - Intergenic
1188099819 X:26070773-26070795 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1191766483 X:64704491-64704513 TGCAGCAGACCTACAGAAGAAGG - Intergenic
1191891520 X:65947417-65947439 TGCTGGGGCCCTTCAGAAGCTGG - Intergenic
1192289867 X:69783207-69783229 AGATGGTTTCCTAAAGAAGATGG + Intronic
1192422150 X:71043323-71043345 TGCAGGTGTACTACATATGATGG - Intergenic
1192634396 X:72804114-72804136 TGCTGGTGTCCTACAGAAGATGG - Intronic
1192647314 X:72916687-72916709 TGCTGGTGTCCTACAGAAGATGG + Intronic
1192884172 X:75319807-75319829 TGCAGCAGACCTACAGAAGAGGG - Intergenic
1193048279 X:77076391-77076413 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1193227328 X:78998897-78998919 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1193719404 X:84970910-84970932 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1194243297 X:91478192-91478214 TGTTGGAGTCATTCAGAAGACGG + Intergenic
1194445985 X:93987284-93987306 TGCAGCAGCCCTACAGAAGAGGG + Intergenic
1195588639 X:106598279-106598301 TGCAGGTGACCTCTAGAAGAAGG - Intergenic
1195979251 X:110560666-110560688 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1196607249 X:117671243-117671265 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1197046375 X:122003592-122003614 TGCAGGAGCCCTACAGAAGAGGG - Intergenic
1197403828 X:126026982-126027004 TGCAGCAGCCCTACAGAAGAGGG - Intergenic
1199754499 X:150851712-150851734 TGCAGGTGACCTCCAGAAGCTGG - Intronic
1200320824 X:155187241-155187263 TGTTGGTGACCTCCAGAAGCTGG + Intergenic
1200755204 Y:6984408-6984430 TGCTGGTGTCCCACCCAAGTCGG + Intronic
1200818332 Y:7555932-7555954 TGCAGCAGCCCTACAGAAGAGGG + Intergenic