ID: 1192634397

View in Genome Browser
Species Human (GRCh38)
Location X:72804131-72804153
Sequence GAGAACAGTCGGAAGACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 2, 1: 1, 2: 0, 3: 9, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192634397_1192634402 21 Left 1192634397 X:72804131-72804153 CCAGCAGTCTTCCGACTGTTCTC 0: 2
1: 1
2: 0
3: 9
4: 113
Right 1192634402 X:72804175-72804197 AGAATTACCTCAGGTGACCATGG 0: 2
1: 0
2: 2
3: 13
4: 155
1192634397_1192634401 12 Left 1192634397 X:72804131-72804153 CCAGCAGTCTTCCGACTGTTCTC 0: 2
1: 1
2: 0
3: 9
4: 113
Right 1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG 0: 2
1: 0
2: 0
3: 5
4: 82
1192634397_1192634403 22 Left 1192634397 X:72804131-72804153 CCAGCAGTCTTCCGACTGTTCTC 0: 2
1: 1
2: 0
3: 9
4: 113
Right 1192634403 X:72804176-72804198 GAATTACCTCAGGTGACCATGGG 0: 2
1: 0
2: 0
3: 5
4: 79
1192634397_1192634404 23 Left 1192634397 X:72804131-72804153 CCAGCAGTCTTCCGACTGTTCTC 0: 2
1: 1
2: 0
3: 9
4: 113
Right 1192634404 X:72804177-72804199 AATTACCTCAGGTGACCATGGGG 0: 2
1: 0
2: 0
3: 10
4: 125
1192634397_1192634400 -10 Left 1192634397 X:72804131-72804153 CCAGCAGTCTTCCGACTGTTCTC 0: 2
1: 1
2: 0
3: 9
4: 113
Right 1192634400 X:72804144-72804166 GACTGTTCTCAGGAGTACTCTGG 0: 2
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192634397 Original CRISPR GAGAACAGTCGGAAGACTGC TGG (reversed) Intronic
904033810 1:27548805-27548827 GAGAACTGTCGGCAGTTTGCGGG - Exonic
906836096 1:49084737-49084759 GAGAAGAGTCTGAATGCTGCAGG - Intronic
913168126 1:116208317-116208339 GAGAGAAGCCGGAAGACAGCGGG - Intergenic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
923859457 1:237878443-237878465 GAGAGAAGTTGGAAGTCTGCTGG - Intronic
924598702 1:245469181-245469203 GAGTGCAGTAGGAAGACTCCAGG - Intronic
1065990478 10:31004585-31004607 TAGACACGTCGGAAGACTGCTGG + Intronic
1071302345 10:84265426-84265448 GAGAACAGAGGGAAGACTTAAGG - Intergenic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1072728235 10:97827940-97827962 GAAATCAGTGGGATGACTGCAGG - Intergenic
1076501836 10:130943331-130943353 AAGAACAGCTGGAAGACTACTGG + Intergenic
1079328008 11:19511176-19511198 GAGAACAGTCGGGAGACACATGG + Intronic
1085037112 11:73307513-73307535 GAGAAGAGCCGCCAGACTGCAGG + Intergenic
1085039138 11:73316872-73316894 GAGGCCAGTCAGAAGGCTGCTGG + Intronic
1085250607 11:75141170-75141192 GTGAACAGGAGGAAGGCTGCAGG + Intronic
1087917266 11:103825402-103825424 GGGAACAGGAGGCAGACTGCTGG + Intergenic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1089700848 11:120242932-120242954 GAAAACAGTGGGAAGCCAGCGGG + Intronic
1090084566 11:123640083-123640105 GAGAGCAGTCCGAAGGCTCCAGG + Intronic
1090113657 11:123943161-123943183 GAGAACAGTGGCAAGAATGCAGG + Exonic
1090655165 11:128837672-128837694 AAGAACAGTGGGAAGTCTGATGG - Intronic
1094661767 12:32476179-32476201 GACAACAGCTAGAAGACTGCTGG - Intronic
1097104290 12:56611979-56612001 GAGACCACTGAGAAGACTGCTGG + Exonic
1099673649 12:85728681-85728703 GAGAACAGCCGGCAGGCTCCAGG - Intergenic
1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG + Intronic
1110184334 13:72655894-72655916 GAGAACAGAAGGAAGAATGTAGG + Intergenic
1111982478 13:95031423-95031445 GAGAACAGAAGGTAGATTGCTGG - Intronic
1112610806 13:100952931-100952953 GAGGGCAGCAGGAAGACTGCTGG - Intergenic
1113366869 13:109684562-109684584 GAGATAAGTCGGAGAACTGCAGG - Intergenic
1118253955 14:64188859-64188881 GAGAACAGTTGGAAGAGAGGAGG + Intronic
1123415700 15:20093470-20093492 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123525039 15:21100584-21100606 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1125430990 15:39593344-39593366 GAGAACCTTCTGAAGGCTGCAGG + Intronic
1127476855 15:59342426-59342448 GAAAACATTGGGAAGACTCCAGG - Intronic
1127939626 15:63681850-63681872 GAGAACAGAAGGAAGCCTACAGG + Intronic
1128532742 15:68465633-68465655 GAGAACTGGCTGAAGACTGGTGG - Intergenic
1129958117 15:79657848-79657870 GAGGACAAAAGGAAGACTGCAGG - Intergenic
1130760190 15:86811330-86811352 GAGAACAGTCAGAAGGCTACTGG + Intronic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1141126539 16:81404585-81404607 GAGGACAGTTAGGAGACTGCTGG - Intergenic
1147871187 17:43588766-43588788 GAGGACAGTCAGAAGAGAGCAGG - Intergenic
1151594176 17:75066833-75066855 GAGAACAGTGGGAAGACATTGGG + Intergenic
1156570672 18:38249160-38249182 GGGGACAGTGGGAAGACTGTGGG - Intergenic
1156997127 18:43482149-43482171 TAGAACAGTCGAGAGACAGCAGG - Intergenic
1158995504 18:62914535-62914557 GGGTACAGTGGGAGGACTGCTGG - Intronic
1160361948 18:78290769-78290791 CAGAATAGTGGGAAGACAGCGGG - Intergenic
1161107853 19:2453475-2453497 GAGCAGAGTTGGAAGCCTGCTGG - Intronic
1164159123 19:22615263-22615285 AGGAACAGAAGGAAGACTGCTGG + Intergenic
1164907634 19:31980308-31980330 TGGAACAGTCGGAAGAATGATGG - Intergenic
1168319983 19:55503454-55503476 GAGAGCACGCGGGAGACTGCAGG - Intronic
925031742 2:655079-655101 GAGCAGAGGCGGAAGCCTGCTGG + Intergenic
926619960 2:15038658-15038680 GTGAACAGTAGGAGGACTTCTGG + Intergenic
929243461 2:39676504-39676526 GAGACCGGTGGGAAGTCTGCAGG - Intronic
929872852 2:45773184-45773206 GAGCAGAGTTGGAAGACTGTGGG - Intronic
932355076 2:71061688-71061710 GAGAACTGGAGGAATACTGCTGG + Intergenic
933249070 2:80008286-80008308 GAGCACAGTGGGGTGACTGCGGG - Intronic
933976772 2:87518417-87518439 GATAACAGACAGAAGGCTGCTGG - Intergenic
934886468 2:98029723-98029745 GAGAAAAGGCGGAAGACAGAAGG + Intergenic
935598722 2:104900525-104900547 GAGAAGAGTAGGAAGGCTGGGGG - Intergenic
936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG + Intergenic
940136286 2:150439769-150439791 GGGAACAGGCACAAGACTGCAGG - Intergenic
943171916 2:184412515-184412537 GAGAACATTCAGAAGACTTTTGG + Intergenic
944660717 2:201919373-201919395 GAGAACAGTCTGAACACAGAAGG - Intergenic
944706383 2:202293170-202293192 TAGAACAATCGGATGAATGCAGG + Intronic
948030913 2:234816685-234816707 AAAAACAGTCCGGAGACTGCAGG - Intergenic
948715597 2:239859200-239859222 GAGAACTGCAGGAAGACTTCTGG + Intergenic
948959327 2:241319892-241319914 GAAAACAGTAAGAAAACTGCTGG - Intronic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1170982371 20:21226755-21226777 GAGATCAGGCTGAGGACTGCTGG - Intronic
1175383288 20:58578128-58578150 GAAAACACTCGGAAGGGTGCTGG - Intergenic
1180954375 22:19735094-19735116 GAGAACATGGGGAGGACTGCAGG - Intergenic
1181681193 22:24496851-24496873 GAGGACAGCAGGAAGTCTGCTGG + Intronic
1182544386 22:31066009-31066031 GAGGACAGACAGAAGTCTGCAGG - Intronic
1184334898 22:43847428-43847450 GAGACCAGTGGGAGGAGTGCTGG - Intronic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
950915290 3:16638356-16638378 GAGAGTAGTGGGAAAACTGCAGG - Intronic
954256629 3:49411929-49411951 GAGAACCGACGGAGGACCGCGGG + Exonic
955012204 3:55029084-55029106 GAGAACAGTCTAAAGACTTGTGG - Intronic
957773897 3:84730362-84730384 TAGAACAGTAGGAAGACAGACGG - Intergenic
961317816 3:126052483-126052505 GAGAGCAGGAGGAAGGCTGCTGG - Intronic
962379430 3:134885672-134885694 GAGAACATTTGGAAAACTTCTGG + Intronic
963843927 3:150135525-150135547 GAGAACATTCTGTAGCCTGCTGG - Intergenic
969436831 4:7193433-7193455 CAGAACCTTCGGAAGCCTGCAGG + Intronic
971119365 4:23687113-23687135 GAGAATGGTTGGAAGGCTGCAGG + Intergenic
973073533 4:45895129-45895151 GAGAACATTTTGAAGATTGCTGG - Intergenic
975064510 4:70043486-70043508 GAGAAGAGTCAGAACACTGAAGG - Intergenic
975135821 4:70873423-70873445 GAGCGCAGTCCGAAGACAGCAGG - Intergenic
976203260 4:82600155-82600177 GGGAAAAGACGGAAGAATGCAGG - Intergenic
981875121 4:149532941-149532963 GAGGTCAGTGGGAAGACAGCAGG + Intergenic
985575599 5:672127-672149 GGGAACAGTCCGAAGACTTTAGG + Intronic
995275929 5:110277790-110277812 GAGAACATTCAGAATAGTGCTGG - Intergenic
995569449 5:113463953-113463975 GAGAACAGCAAGAAGACTGTGGG + Intronic
998586229 5:143430642-143430664 GAGGACAGTGAGAAGACAGCGGG + Intronic
998999169 5:147900969-147900991 GAGAACATTGGGAAGACTCTGGG + Intronic
1002170135 5:177370369-177370391 GAGAAAAGTGGCAAGAATGCTGG - Intronic
1002294669 5:178223763-178223785 GACAACAGAGGGAAGACTGTTGG - Intronic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1006088608 6:31614823-31614845 GAGAAGAATCTGAAGTCTGCTGG - Intergenic
1007228337 6:40330269-40330291 GAGGACAGTGAGAAGGCTGCTGG - Intergenic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1022397740 7:30005740-30005762 AAAAACAGTTGGAAGACTCCGGG - Intergenic
1025017446 7:55450259-55450281 GAGAAGAGGCGGAGGACTGGTGG - Intronic
1026447136 7:70494659-70494681 GAGAACAGACTGGAGACTGCTGG + Intronic
1028067901 7:86411421-86411443 GAGAAAACTCTGAAGATTGCCGG - Intergenic
1028492461 7:91427328-91427350 GAGCACTGATGGAAGACTGCTGG - Intergenic
1028809405 7:95067343-95067365 TAAAACAGTCAGAAGACTCCAGG + Intronic
1032187807 7:129742428-129742450 GGGCAGAGTCGGAAGACTGCTGG - Intronic
1032578060 7:133076612-133076634 GAGATGAGTGGGAAGACTGTAGG - Intronic
1034217873 7:149421985-149422007 GAGAAAAGTGGGTAGAATGCAGG + Intergenic
1036111218 8:5905051-5905073 GAGAACAGAGGCAAGTCTGCCGG + Intergenic
1040301433 8:46189993-46190015 GAGAGAAGGCGCAAGACTGCAGG + Intergenic
1042556683 8:70039284-70039306 GAGAACAGTGACAAGAGTGCAGG + Intergenic
1047957053 8:129984206-129984228 GACAACAGTCAGAGGGCTGCAGG + Intronic
1059733701 9:117081217-117081239 GAGAACAGCTGAGAGACTGCAGG - Intronic
1203493116 Un_GL000224v1:125470-125492 AAGAACATTCAGAAGACAGCAGG - Intergenic
1203505736 Un_KI270741v1:67345-67367 AAGAACATTCAGAAGACAGCAGG - Intergenic
1191226376 X:58048759-58048781 GAGAAAGGTGGGAAGACTGATGG - Intergenic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1192018038 X:67352992-67353014 GGGACCAGTTGGAATACTGCAGG - Intergenic
1192173610 X:68872323-68872345 GAGACCAGCCGGCAGGCTGCAGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1197783621 X:130179534-130179556 GAGGTCAGTAGGAAGACAGCAGG - Intronic
1197867255 X:131032493-131032515 GAGATCAGTAGGCAGACAGCTGG - Intergenic
1198844179 X:140892068-140892090 GAGAACAGCTGGAAGATGGCAGG + Intergenic