ID: 1192634400

View in Genome Browser
Species Human (GRCh38)
Location X:72804144-72804166
Sequence GACTGTTCTCAGGAGTACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 2, 1: 0, 2: 1, 3: 10, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192634394_1192634400 20 Left 1192634394 X:72804101-72804123 CCACGGTTAGGCTCCATCTTCTG 0: 2
1: 0
2: 0
3: 11
4: 162
Right 1192634400 X:72804144-72804166 GACTGTTCTCAGGAGTACTCTGG 0: 2
1: 0
2: 1
3: 10
4: 98
1192634397_1192634400 -10 Left 1192634397 X:72804131-72804153 CCAGCAGTCTTCCGACTGTTCTC 0: 2
1: 1
2: 0
3: 9
4: 113
Right 1192634400 X:72804144-72804166 GACTGTTCTCAGGAGTACTCTGG 0: 2
1: 0
2: 1
3: 10
4: 98
1192634396_1192634400 7 Left 1192634396 X:72804114-72804136 CCATCTTCTGTAGGACACCAGCA 0: 2
1: 0
2: 0
3: 28
4: 316
Right 1192634400 X:72804144-72804166 GACTGTTCTCAGGAGTACTCTGG 0: 2
1: 0
2: 1
3: 10
4: 98
1192634393_1192634400 21 Left 1192634393 X:72804100-72804122 CCCACGGTTAGGCTCCATCTTCT 0: 2
1: 0
2: 1
3: 36
4: 118
Right 1192634400 X:72804144-72804166 GACTGTTCTCAGGAGTACTCTGG 0: 2
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192634400 Original CRISPR GACTGTTCTCAGGAGTACTC TGG Intronic
901270631 1:7950749-7950771 GTGTGTTCTCAGGAGTGCTCTGG - Intergenic
906693234 1:47806754-47806776 GACTGTTTACAGGACTACTCTGG - Intronic
907049696 1:51321809-51321831 GGCTGCTCTCAGGAGTCCTGGGG + Exonic
907683160 1:56583319-56583341 GCCTTTTCTCAGGAGTATTACGG - Intronic
913581664 1:120233076-120233098 GACTGTTCTCAGTAGGAGGCTGG - Intergenic
913626513 1:120665312-120665334 GACTGTTCTCAGTAGGAGGCTGG + Intergenic
914563595 1:148844523-148844545 GACTGTTCTCAGTAGGAGGCTGG - Intronic
914609232 1:149285703-149285725 GACTGTTCTCAGTAGGAGGCTGG + Intergenic
915334807 1:155135033-155135055 GACAGCTGTCAGGAGCACTCCGG - Intergenic
915528688 1:156491067-156491089 GACTGTTCTCAGAAGTATTTGGG + Intronic
916048883 1:161021102-161021124 GTCTGTTCCCAGGAGTCCTTCGG - Exonic
918389736 1:184046385-184046407 TTCTGTTCTCTGGAGAACTCTGG + Intergenic
919367730 1:196685751-196685773 GGCTGTTGTCAGGAGGCCTCAGG + Intronic
922199565 1:223390437-223390459 GAAGGTTCTCAGGATTCCTCAGG - Intergenic
923821285 1:237445477-237445499 GACTGTGCTCCGGATAACTCGGG - Exonic
1063325382 10:5095498-5095520 GACTGTTCTCAGGAGATGGCGGG + Intronic
1071028614 10:81144691-81144713 GACGGTTCTGAGGAGTCCTGGGG + Intergenic
1073194891 10:101682353-101682375 TACTGTCCTCAGCAGTAGTCTGG - Intronic
1074262115 10:111864374-111864396 TAATTTTCTCAGGAGTACTTGGG - Intergenic
1078158463 11:8818598-8818620 GCCTGTTCTGAGGAGTACTGGGG - Intronic
1078696894 11:13643215-13643237 GACAGTTTTGAGGAGTTCTCTGG - Intergenic
1080774194 11:35370600-35370622 GAGTGTTATAAGGTGTACTCTGG + Intronic
1083335645 11:61920167-61920189 GACTCTTCTGAGGAGCACGCTGG - Intronic
1087782245 11:102313376-102313398 GACTGTAGTCAGAACTACTCAGG + Intergenic
1089616775 11:119699334-119699356 GACTGTCCTCAAGGGAACTCTGG + Intronic
1090191655 11:124774766-124774788 GACTATTCACAGGAGGACTGGGG - Exonic
1102612877 12:114128119-114128141 AACTGTTCACAGGAATGCTCTGG - Intergenic
1105985556 13:25562757-25562779 GCCTGGGCTCAGGACTACTCTGG + Intronic
1106397055 13:29391309-29391331 GATAGTTCTCAGAAGTAATCTGG - Intronic
1109347493 13:61132995-61133017 ATCTGTTCTCAGCAGAACTCTGG - Intergenic
1109518768 13:63481298-63481320 GAGTGCTCTCAGGAGAAATCTGG + Intergenic
1120267453 14:82269504-82269526 CACTGTTCTCAGGAAAACACAGG - Intergenic
1127551108 15:60039294-60039316 CACTGTACTCAGGAGTCTTCAGG + Intronic
1130603890 15:85297687-85297709 GAGGGTGCTCTGGAGTACTCAGG - Intergenic
1131044238 15:89300046-89300068 GACTGTTCTCAAGTGTCTTCTGG - Intronic
1132585048 16:702454-702476 GTCTGTCCTCAAGAGTCCTCAGG - Intronic
1134569092 16:15276201-15276223 GGCAGTTTTCAGGAGTACTGGGG + Intergenic
1134733285 16:16479843-16479865 GGCAGTTTTCAGGAGTACTGGGG - Intergenic
1134934153 16:18232129-18232151 GGCAGTTTTCAGGAGTACTGGGG + Intergenic
1138604809 16:58081787-58081809 TACTGTACTCAGGAGGCCTCAGG + Intergenic
1140214541 16:72996806-72996828 GACTGGTCTGACCAGTACTCCGG + Intronic
1146125056 17:30224841-30224863 GTGTGTTCTCAGGAGTCCTCAGG + Intronic
1147911649 17:43859648-43859670 GTCTGATGTCAGGAGTCCTCTGG + Intronic
1148925227 17:51078365-51078387 GACTGTTCTCTCTAGTACTCTGG - Intronic
1152295489 17:79464784-79464806 GCCTGTTCTCAGCTGTCCTCGGG - Intronic
1155872597 18:31046116-31046138 GGCTGTTCTCAATAGTGCTCTGG - Intergenic
1159222167 18:65479372-65479394 GTCTTCTCTCAGGAGAACTCAGG + Intergenic
1159948723 18:74463131-74463153 CACTGTGCTCATGTGTACTCCGG - Intergenic
926095571 2:10079406-10079428 GACTGTTATTACGAGTATTCAGG + Intronic
927920439 2:26968299-26968321 GCTTCTTCTCAGGATTACTCAGG + Intergenic
927957120 2:27215334-27215356 AACTGTTCTCTGGAGGACCCTGG + Exonic
931493971 2:62782664-62782686 TACTGTTCTTATGAGTTCTCAGG - Intronic
932446841 2:71786735-71786757 GACTGCTCTCAGGTGCACTGTGG - Intergenic
934149420 2:89131086-89131108 GAATGTTCCCTGGAGTCCTCAGG - Intergenic
934217874 2:90050955-90050977 GAATGTTCCCTGGAGTCCTCAGG + Intergenic
935263549 2:101375564-101375586 GAATGTTTTCAGGAGCCCTCAGG + Intronic
936159937 2:110077294-110077316 AACTGTTCCCATGAGTTCTCTGG - Intergenic
936184727 2:110294059-110294081 AACTGTTCCCATGAGTTCTCTGG + Intergenic
937015215 2:118598927-118598949 CACAGTTCTCAGGAGTAGCCTGG - Intergenic
937169725 2:119854010-119854032 GACTGTTTTCTGGTGCACTCAGG - Intronic
937943494 2:127309676-127309698 GACATTTCTGAGGAGTACTGGGG + Intronic
938498046 2:131813597-131813619 GTCTGTGCTGAGGAGTACGCAGG + Intergenic
938552361 2:132393801-132393823 AAGTGTTTTCAGGAGTAGTCAGG - Intergenic
943718107 2:191174351-191174373 GAGTTGTCTCAGGAGTGCTCAGG + Intergenic
948975967 2:241464159-241464181 GACTGTTCTGAGGGGGACCCTGG - Intronic
1173746028 20:45437736-45437758 GAGAGTTCTCAGGAATTCTCCGG + Intergenic
1175976994 20:62715836-62715858 GTCTGTTCTCAGGGGCACTGGGG + Intronic
952960905 3:38588646-38588668 CACTGTTCTCAGGGGTACTCTGG - Intronic
953756116 3:45647364-45647386 GACTCTTCCCAGGAGTACTGAGG + Intronic
955735083 3:62030334-62030356 GACTGTTTTCATGAGGAATCTGG - Intronic
964843127 3:161015993-161016015 GACTGTTCTCAGGAACACCCAGG - Intronic
965942904 3:174206972-174206994 GACTGGTCTCAGGATTACCATGG + Intronic
966834565 3:184039017-184039039 GACTGGTTTCTGGAGTTCTCTGG - Exonic
967972427 3:195009132-195009154 AGCTGGTGTCAGGAGTACTCTGG - Intergenic
972082145 4:35166173-35166195 AAATGTTCTCAGGATGACTCTGG + Intergenic
978383537 4:108156284-108156306 GACTGTTTTCAGGAGTTATCTGG + Intronic
980271147 4:130585073-130585095 TACTGTTCTCACAAGTACTGTGG - Intergenic
980600852 4:135022304-135022326 GGCTGTTCTCAGCTGCACTCAGG + Intergenic
985176804 4:187210991-187211013 GACTGTTTTCAAGAGCAGTCAGG - Intergenic
989255925 5:39365596-39365618 TACTGTTCTCAAGAGTCCCCAGG - Intronic
995059591 5:107798884-107798906 AACTGTCCTCAGGAGTGATCTGG - Intergenic
995711589 5:115041373-115041395 GACTGTTCTCAGTTCTATTCAGG - Intergenic
996346885 5:122497246-122497268 ACCTGTTCTCAGGTGTAATCAGG - Intergenic
997589266 5:135062924-135062946 GACTGTCCTCAGATGTCCTCTGG + Intronic
998061222 5:139120208-139120230 GACTGTTCTCAGGAGTGGCAAGG - Intronic
999113713 5:149142962-149142984 GACTGTTCATAGGGGTTCTCTGG - Intronic
1001233652 5:170011237-170011259 AACTGTTCTCTGCAGTGCTCAGG - Intronic
1001645610 5:173279698-173279720 GCCTGTTCTCAGGAGTTCTTGGG + Intergenic
1002568591 5:180127768-180127790 GACTGTTGTGAGGAGGACTAGGG - Intronic
1003477553 6:6498147-6498169 GTCTGGGCTCAGGAGTCCTCAGG + Intergenic
1011935907 6:92776843-92776865 GATTGTTCTCAGTATTGCTCTGG - Intergenic
1019483279 7:1275939-1275961 GACAGTTCTCAGGAGCAGTGTGG + Intergenic
1023695262 7:42839006-42839028 GACTGCTCTAAGGAATACTAGGG - Intergenic
1028016174 7:85716262-85716284 AACTGTGCTAAGGAGTAGTCAGG - Intergenic
1031022798 7:116646362-116646384 GCCTGTACTCACAAGTACTCAGG + Intergenic
1031660478 7:124417814-124417836 GACTGGTGTCAGGATTACTTGGG + Intergenic
1033466915 7:141600647-141600669 GACTGTTGTCAGGACTAGACTGG - Intronic
1038127286 8:24688990-24689012 GACTGGTCTAAGGAATACCCAGG + Intergenic
1038254199 8:25935450-25935472 GGCTGTTGTCAGGGGTACTGGGG + Intronic
1041314547 8:56547353-56547375 GACTGTTTTGAGGAGTAATAAGG - Intergenic
1042389502 8:68217047-68217069 CACTTTTCTCAGGGCTACTCTGG + Intronic
1044009896 8:86981896-86981918 GTCTGTTCACAGTTGTACTCTGG + Intronic
1049207252 8:141369338-141369360 GACTCTTCTCAGCAGGACCCAGG + Intergenic
1051369719 9:16348119-16348141 GACTGTTTTAAGGAGGTCTCTGG + Intergenic
1053011120 9:34634090-34634112 GACTGTTCCCAGGATTGCACCGG + Intergenic
1055336363 9:75236909-75236931 GACTGTTCACAGGAATATCCAGG - Intergenic
1187567281 X:20463796-20463818 AAGTGCTCTCAGGAGCACTCTGG - Intergenic
1192634400 X:72804144-72804166 GACTGTTCTCAGGAGTACTCTGG + Intronic
1192647310 X:72916657-72916679 GACTGTTCTCAGGAGTACTCTGG - Intronic
1199818980 X:151425730-151425752 GGCTGTTGCCAGGAGTCCTCAGG - Intergenic
1201966400 Y:19741226-19741248 GACTTTTCTCTTGAGTAGTCAGG - Intronic