ID: 1192634403

View in Genome Browser
Species Human (GRCh38)
Location X:72804176-72804198
Sequence GAATTACCTCAGGTGACCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192634399_1192634403 11 Left 1192634399 X:72804142-72804164 CCGACTGTTCTCAGGAGTACTCT 0: 2
1: 0
2: 0
3: 13
4: 142
Right 1192634403 X:72804176-72804198 GAATTACCTCAGGTGACCATGGG 0: 2
1: 0
2: 0
3: 5
4: 79
1192634397_1192634403 22 Left 1192634397 X:72804131-72804153 CCAGCAGTCTTCCGACTGTTCTC 0: 2
1: 1
2: 0
3: 9
4: 113
Right 1192634403 X:72804176-72804198 GAATTACCTCAGGTGACCATGGG 0: 2
1: 0
2: 0
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192634403 Original CRISPR GAATTACCTCAGGTGACCAT GGG Intronic
900446980 1:2686155-2686177 GCATAACCACAGGTGAACATCGG + Intronic
900448474 1:2693581-2693603 GCATAACCACAGGTGAACATCGG + Intronic
900451441 1:2751924-2751946 GCATAACCACAGGTGAACATCGG + Intronic
900451947 1:2754533-2754555 GCATAACCACAGGTGAACATCGG + Intronic
902574370 1:17367912-17367934 CAGTGACCTCAAGTGACCATGGG + Intergenic
903969335 1:27108841-27108863 GAATGAACCCAGGAGACCATGGG - Intronic
911764940 1:101662844-101662866 GAATTACCTAAGGTCACCTAGGG + Intergenic
917074411 1:171189025-171189047 GAATTTGCTCAGGGGAACATAGG + Intronic
917662742 1:177193496-177193518 GAATTACCACAGGTGCCTGTTGG - Intronic
920846724 1:209599570-209599592 GTATTCCCTTACGTGACCATAGG + Intronic
923501130 1:234565615-234565637 GAATTAGAGCAGGTGAGCATTGG - Intergenic
924507403 1:244698791-244698813 GGATTATCACAGGTGTCCATGGG + Intronic
1067019374 10:42781817-42781839 GCATTTCCTCAGGTGGCAATGGG + Intergenic
1067499042 10:46785869-46785891 GCATTTCCTCAGGTGGCAATGGG + Intergenic
1067595600 10:47554504-47554526 GCATTTCCTCAGGTGGCAATGGG - Intergenic
1067951016 10:50738815-50738837 GCATTTCCTCAGGTGGCAATGGG + Intergenic
1070821670 10:79359315-79359337 GAATTGGCTCATGTGATCATGGG - Intergenic
1070886375 10:79904027-79904049 GCATTTCCTCAGGTGGCAATGGG + Intergenic
1077930356 11:6724959-6724981 AAATTACCTCAAGGGACCAAAGG + Intergenic
1083152179 11:60798754-60798776 GAACTACCTCAGCTGAACCTGGG + Intronic
1086930092 11:92683361-92683383 AAGTTACCTCAGGAGACCTTAGG - Intronic
1087705276 11:101483260-101483282 CAATTATCTCAGGAGATCATTGG - Intronic
1092292044 12:7165967-7165989 GATTTACCTCTGCTGACCACAGG - Intergenic
1092913733 12:13171266-13171288 GAATTTCCTCTGTTGACCATGGG + Intergenic
1098509624 12:71296524-71296546 GAATTATATCAGGAGACCACTGG + Intronic
1105025156 12:132843479-132843501 AAATTACCCCAGTTGACTATTGG + Intronic
1114361152 14:21974619-21974641 GAATCAACTCAGGTGCCAATCGG - Intergenic
1115335755 14:32243089-32243111 CAATCACCTTAGGTCACCATGGG - Intergenic
1115583995 14:34791409-34791431 AAATTATCTGAGGTGACAATAGG + Intronic
1117788670 14:59314893-59314915 AACTTGCCTTAGGTGACCATAGG - Intronic
1121930791 14:97970461-97970483 GAATTACCTCAAGTCAGCAAGGG + Intronic
1127065197 15:55230022-55230044 GAATTAATTCATGTGACCAGGGG - Intronic
1133494661 16:6305665-6305687 GTATTACCTCATTTGATCATGGG + Intronic
1139720506 16:68848937-68848959 GAAATACCTCAGATGAGCCTGGG - Intronic
1141357860 16:83365461-83365483 GAGTCAACTCAGCTGACCATGGG - Intronic
1141586983 16:85040585-85040607 GAATTACCTCTGGTAACGTTGGG + Intronic
1144647410 17:16984788-16984810 GAATTGGCTCAGGTGACTGTGGG - Intergenic
933178550 2:79203908-79203930 CTTCTACCTCAGGTGACCATGGG - Intronic
946181058 2:217949152-217949174 GAATTTCCTCTGGTCACCAAGGG - Intronic
1175137442 20:56835059-56835081 AAATTAACTCATGTGCCCATTGG + Intergenic
1175693113 20:61080409-61080431 CAATTCCCTCAAGTGACCAGTGG + Intergenic
1178060032 21:28842729-28842751 GATTTATTTCAGGTGATCATGGG + Intergenic
1180699460 22:17773761-17773783 GAATGACCCCAGGGGACCCTGGG - Exonic
1184429213 22:44431429-44431451 GAACTTCCACAGGGGACCATGGG + Intergenic
1185362568 22:50417426-50417448 GAAGCACCTAAGGTGACAATGGG + Intronic
952415270 3:33084318-33084340 GAACTATTTCAGGTGACTATGGG + Intronic
957202465 3:77154611-77154633 GAATCAACCAAGGTGACCATCGG + Intronic
957346856 3:78972137-78972159 GAATTAACTCATATGACCAATGG - Intronic
960168295 3:114428863-114428885 GAATTAACTTCTGTGACCATTGG - Intronic
960809364 3:121613357-121613379 GCATTGCCTCAGGCGACCATGGG - Intronic
962055603 3:131868210-131868232 GCTTTACTTCAGGTGGCCATGGG - Intronic
963917467 3:150872086-150872108 TACTTACCTCATGTGACTATTGG + Intronic
965065021 3:163837143-163837165 GAATTACCTCAGGTGGTTAATGG + Intergenic
971159761 4:24121603-24121625 GAACAACCACAGGTGACCAGGGG + Intergenic
972125942 4:35765705-35765727 GAGTTACCTTAGATGCCCATCGG - Intergenic
972733079 4:41814142-41814164 GAATTACCTCAGTCCACCCTGGG + Intergenic
974142860 4:57909853-57909875 GAATTTCCTAAGATGACTATAGG - Intergenic
979936436 4:126703079-126703101 GAAATCCCTCAGGTAACCATAGG + Intergenic
981485269 4:145279353-145279375 GAATAACATCTGGTGAGCATGGG + Intergenic
981997237 4:150988148-150988170 AAATTGCCTGAGGTCACCATGGG - Intronic
990373486 5:55145464-55145486 GAATTACATCAGCTGATGATAGG + Intronic
993097911 5:83502413-83502435 GAATGACCTCAGGTCAACACAGG - Intronic
994459173 5:100051731-100051753 GCATTACATCACGTCACCATTGG + Intergenic
996416503 5:123216532-123216554 GAATTCCCTCAGGTTACAATTGG + Intergenic
998379448 5:141713688-141713710 GAATTTCCTCAGTTCAGCATAGG - Intergenic
1001534033 5:172486089-172486111 GACTTACCTCAGAGGACCATGGG - Intergenic
1005910874 6:30308402-30308424 GAAAAACCTCTGATGACCATGGG + Intergenic
1011294330 6:85810076-85810098 GAGTTACCCCAGGTTACCAGTGG - Intergenic
1011451400 6:87496256-87496278 GAATTTCTTCAGGTAACCAAAGG + Intronic
1021378128 7:19934128-19934150 GATTTGTCTCAGGTGACCCTGGG - Intergenic
1021674790 7:23069188-23069210 GAATAACCCTAGGTAACCATTGG + Intergenic
1023158887 7:37278656-37278678 GAATTACCTCATGGGATTATGGG - Intronic
1027361287 7:77413217-77413239 CAATATCCTCAGGTGACCTTGGG + Intronic
1027555509 7:79659870-79659892 TACTGACCTCAGGTGACAATCGG + Intergenic
1031591732 7:123601099-123601121 GGATTAACTCAGGCCACCATCGG - Intronic
1038022415 8:23561655-23561677 GAATTACCCCTGGTGACCTATGG - Intronic
1042032036 8:64486926-64486948 GATTTACCTAAGGAGACAATCGG + Intergenic
1050268074 9:3912143-3912165 GAATTACATGAGGTGACCTAAGG + Intronic
1052364797 9:27600123-27600145 GATTTACCTGAGGTGACTTTTGG - Intergenic
1060475960 9:123986933-123986955 GAAGTACAGCAGGAGACCATTGG - Intergenic
1061719909 9:132545144-132545166 GATTTGACTCAGCTGACCATGGG + Intronic
1188511420 X:30940298-30940320 GAATTACTTCAGCTGGGCATTGG - Intronic
1192634403 X:72804176-72804198 GAATTACCTCAGGTGACCATGGG + Intronic
1192647307 X:72916625-72916647 GAATTACCTCAGGTGACCATGGG - Intronic
1197411785 X:126124599-126124621 GAATTATCTCAGGGGTCTATGGG + Intergenic
1199475867 X:148244509-148244531 GAAATATCTAAGGTGACCCTGGG + Intergenic