ID: 1192634404

View in Genome Browser
Species Human (GRCh38)
Location X:72804177-72804199
Sequence AATTACCTCAGGTGACCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192634397_1192634404 23 Left 1192634397 X:72804131-72804153 CCAGCAGTCTTCCGACTGTTCTC 0: 2
1: 1
2: 0
3: 9
4: 113
Right 1192634404 X:72804177-72804199 AATTACCTCAGGTGACCATGGGG 0: 2
1: 0
2: 0
3: 10
4: 125
1192634399_1192634404 12 Left 1192634399 X:72804142-72804164 CCGACTGTTCTCAGGAGTACTCT 0: 2
1: 0
2: 0
3: 13
4: 142
Right 1192634404 X:72804177-72804199 AATTACCTCAGGTGACCATGGGG 0: 2
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192634404 Original CRISPR AATTACCTCAGGTGACCATG GGG Intronic
903463065 1:23532589-23532611 ACTTACCTCATATGATCATGAGG + Intergenic
905858621 1:41331244-41331266 AACTACCCCAGGGGACCAAGCGG + Intergenic
909145868 1:71930837-71930859 AATAGCCTCAGCTGCCCATGAGG + Intronic
910514505 1:88045013-88045035 AAATACCTTATGTGACCCTGAGG - Intergenic
913708918 1:121460203-121460225 ATTTACCTCAGGTCACTATGTGG - Intergenic
915843733 1:159240091-159240113 AATTGCCTCAGCTTACCAAGTGG + Intergenic
916639325 1:166710086-166710108 AATTGGCTCAGGTAATCATGTGG + Intergenic
919972711 1:202591358-202591380 ACTGCCCTCAGGTGCCCATGGGG + Exonic
922571044 1:226634881-226634903 AATGACCTGAGGAGAACATGGGG + Exonic
922750292 1:228067078-228067100 CATACCCTCAGGTGCCCATGGGG + Intergenic
924816767 1:247448764-247448786 AATTACATGAGGTCACCAAGAGG - Exonic
1065085492 10:22170869-22170891 CATTAACTGAGATGACCATGTGG - Intergenic
1066647677 10:37626047-37626069 AATTAACTCAGGTGTCCTTAAGG + Intergenic
1067017742 10:42770455-42770477 AATCACATCAGGTGAGCATGAGG - Intergenic
1067698008 10:48549324-48549346 AAAGACATCAGGTGACCAGGAGG - Intronic
1070233087 10:74593066-74593088 AATTACCTTAGGTGACTTTTAGG + Intronic
1070821669 10:79359314-79359336 AATTGGCTCATGTGATCATGGGG - Intergenic
1072157724 10:92738995-92739017 AATTAACTGGGGTGACTATGGGG + Intergenic
1074077131 10:110139234-110139256 AATTTCCTCATATCACCATGAGG + Intergenic
1076677373 10:132154065-132154087 CAGTGCCTCAGGTGCCCATGTGG + Intronic
1084091838 11:66883749-66883771 AAATACTTCAGGTCACAATGAGG + Intronic
1086930091 11:92683360-92683382 AGTTACCTCAGGAGACCTTAGGG - Intronic
1087282784 11:96230908-96230930 AGTCATCTCATGTGACCATGAGG - Intronic
1092886299 12:12927225-12927247 AGGAACCTCAGGTGACCATCAGG + Intergenic
1092913734 12:13171267-13171289 AATTTCCTCTGTTGACCATGGGG + Intergenic
1094027115 12:25970453-25970475 AATTTCCTCAGCTGTCCAGGAGG - Intronic
1098695628 12:73550578-73550600 AGTTAACTCTGGTGACAATGAGG + Intergenic
1099104503 12:78482255-78482277 AAGTACTTCAGGTGACCAATTGG - Intergenic
1101568380 12:105931098-105931120 GATAGCCACAGGTGACCATGAGG + Intergenic
1103641047 12:122352725-122352747 AATTACCAAAGGTGATCTTGAGG - Exonic
1104480148 12:129100439-129100461 ACTGACCTCAGATCACCATGAGG - Intronic
1108236097 13:48407008-48407030 AGTTACATCAGATGACCATCAGG + Intronic
1108591487 13:51916679-51916701 ACTGACCTGAGGTGACCCTGAGG - Intergenic
1111204487 13:84987170-84987192 AATTAAATCTGCTGACCATGAGG - Intergenic
1113124459 13:106961355-106961377 ATTTGGCCCAGGTGACCATGTGG + Intergenic
1114067907 14:19081015-19081037 CATCAATTCAGGTGACCATGTGG - Intergenic
1115583996 14:34791410-34791432 AATTATCTGAGGTGACAATAGGG + Intronic
1119262762 14:73247395-73247417 AATGACCTCTGGAGACCCTGTGG + Intronic
1121930792 14:97970462-97970484 AATTACCTCAAGTCAGCAAGGGG + Intronic
1133494662 16:6305666-6305688 TATTACCTCATTTGATCATGGGG + Intronic
1134197338 16:12169400-12169422 AATGACCCCAGGAGGCCATGTGG + Intronic
1135956118 16:26958001-26958023 AATTACCCCAGGTTATCCTGAGG + Intergenic
1138225367 16:55290186-55290208 AATCAGCTCAAGAGACCATGTGG + Intergenic
1138727397 16:59154870-59154892 AATTACTTCAGGGGACAATCTGG + Intergenic
1139432728 16:66919746-66919768 AACTGGCTCAGGTGACCTTGAGG + Intergenic
1140314922 16:73887044-73887066 AAACAACTCAGGTGACCATATGG - Intergenic
1141357859 16:83365460-83365482 AGTCAACTCAGCTGACCATGGGG - Intronic
1141769466 16:86080607-86080629 AATGATGTCAGGTGCCCATGCGG - Intergenic
1144647409 17:16984787-16984809 AATTGGCTCAGGTGACTGTGGGG - Intergenic
1149084912 17:52704431-52704453 TATTAACTCTGGTTACCATGCGG - Intergenic
1153482426 18:5560820-5560842 ATTTGCCTCATGTGACCATAAGG - Intronic
1154066306 18:11110490-11110512 ACTTACCTCAGGTAAACAGGTGG - Intronic
1156465762 18:37347148-37347170 CAATACCTCAGATGACCCTGAGG + Intronic
1156777266 18:40807192-40807214 CAATACCTGAGGTGACTATGTGG + Intergenic
1161062727 19:2223166-2223188 AGTTTCCTCAGGAGACCCTGGGG + Intronic
1163941441 19:20498627-20498649 CATTTCCTCAGGTAACCGTGTGG + Intergenic
1164446308 19:28320336-28320358 AATTTCCTCAGGTGTCCTTTAGG + Intergenic
1167481973 19:49738352-49738374 AATTTCTTCAGGTGAAAATGAGG - Intergenic
927268804 2:21183482-21183504 AATGGCCTCAGGTGCCCTTGGGG + Intergenic
927488773 2:23506685-23506707 CATTACATCATGGGACCATGTGG + Intronic
931032695 2:58198588-58198610 ATTTACCTGAGGTGTCCAGGAGG + Exonic
937258938 2:120573151-120573173 ACTGACCTCAGCTGACCCTGTGG + Intergenic
938485556 2:131703624-131703646 CATCAATTCAGGTGACCATGTGG - Intergenic
938724480 2:134095215-134095237 AATTATCTCAAGTGACCAGAAGG + Intergenic
939186051 2:138861981-138862003 AATTACTACAGGTGACAAAGAGG + Intergenic
940294809 2:152111371-152111393 AAATACCACAGGTGACAATTTGG - Intergenic
943051973 2:182923859-182923881 AAAAACTTCAGGTGACTATGAGG + Intronic
943146559 2:184053601-184053623 GAATACCTCAGTTAACCATGAGG + Intergenic
946556651 2:220865998-220866020 AAGGAACTAAGGTGACCATGAGG + Intergenic
1169302275 20:4454239-4454261 AATTGTCTCATGTGATCATGAGG + Intergenic
1169550876 20:6700104-6700126 CATGACCCCAGGTGACCATCAGG + Intergenic
1172455263 20:35066513-35066535 CATTACCTGAAGTGAACATGAGG - Intronic
1175389293 20:58616145-58616167 ACATAGCTCAGGTGACCTTGTGG + Intergenic
1175693114 20:61080410-61080432 AATTCCCTCAAGTGACCAGTGGG + Intergenic
1178779160 21:35584019-35584041 AATTACCTCACCTGAAAATGGGG + Intronic
1180486381 22:15803582-15803604 CATCAATTCAGGTGACCATGTGG - Intergenic
1184429214 22:44431430-44431452 AACTTCCACAGGGGACCATGGGG + Intergenic
1184569534 22:45313231-45313253 ATTTCCCTCTGGTGACTATGTGG + Intronic
1185362569 22:50417427-50417449 AAGCACCTAAGGTGACAATGGGG + Intronic
950576884 3:13837380-13837402 AAGTACCTCAGGTGGCCGGGGGG - Intronic
952571085 3:34717257-34717279 AAATATCTAAGGTGACAATGTGG - Intergenic
956765785 3:72483079-72483101 AATGACCTCAGGAGGGCATGTGG - Intergenic
956814977 3:72900001-72900023 AATTAACTCAGGTGAACCTGAGG - Intronic
957187339 3:76958732-76958754 AACTTCATCAAGTGACCATGTGG - Intronic
960040944 3:113149301-113149323 AATTACCTCAGTTTAGGATGAGG - Intergenic
963917468 3:150872087-150872109 ACTTACCTCATGTGACTATTGGG + Intronic
964551336 3:157888108-157888130 AATTTCCTCAGCTGAAAATGAGG + Intergenic
965684241 3:171284504-171284526 GAATGCCTCAGCTGACCATGTGG - Intronic
969935917 4:10681004-10681026 AATTTCTACAGGTAACCATGGGG + Intronic
971241745 4:24895650-24895672 AATTTCCTCAGGCAGCCATGAGG - Intronic
972298022 4:37758764-37758786 CATTTCCTCAGATGACCCTGAGG - Intergenic
975343257 4:73264606-73264628 AAGTAACTCAGGTGTCAATGTGG - Intergenic
979108666 4:116721092-116721114 AAGGACCTCAGGTCTCCATGAGG - Intergenic
981372736 4:143978380-143978402 AATTACATCAGGCTGCCATGTGG - Intergenic
983430589 4:167645138-167645160 AAATACCACAGGTCACCAGGAGG + Intergenic
989968587 5:50494498-50494520 ATTTACCTCAGGTCACAATGTGG + Intergenic
991393145 5:66171344-66171366 AATTAACTTAGGTGACAAAGAGG - Intronic
991691744 5:69232074-69232096 AATTCACTCAGGCAACCATGTGG - Intergenic
993085110 5:83354359-83354381 AATAACCTAGGGTGACAATGTGG - Intergenic
995412260 5:111872109-111872131 AATTTGCTCAGGTGATTATGGGG + Intronic
997000079 5:129748927-129748949 ATTTTCCACAGGTGTCCATGTGG + Intronic
1001534032 5:172486088-172486110 ACTTACCTCAGAGGACCATGGGG - Intergenic
1004073376 6:12322835-12322857 TATTAACTCATGGGACCATGTGG - Intergenic
1005409089 6:25523460-25523482 ATTTGCCTAAGGTGACCATGAGG + Intronic
1005910875 6:30308403-30308425 AAAAACCTCTGATGACCATGGGG + Intergenic
1006027468 6:31156778-31156800 AGAGACCTCAAGTGACCATGTGG - Exonic
1006144379 6:31949593-31949615 AATTACTTCAGGGGAACCTGAGG - Intronic
1006896759 6:37476184-37476206 AATCCCATCAGGTGAGCATGTGG + Exonic
1009628349 6:66164813-66164835 AAGTACTTCAGGTGACCAATTGG + Intergenic
1009703530 6:67214896-67214918 TATTACCTCAGGTGATCACAAGG - Intergenic
1011744026 6:90391769-90391791 AATGACCTCAGTTAACCATAAGG + Intergenic
1031943446 7:127813970-127813992 ATTTCCCTCAGGTGAGCATACGG - Intronic
1034828128 7:154285658-154285680 AATTTCCTTAGGTGGCCATGTGG - Intronic
1038954797 8:32456029-32456051 ATTTCCCTCAGGAGACCAAGTGG - Intronic
1039864507 8:41489883-41489905 ACATCCCTCAGGTGACCAAGGGG - Intergenic
1041477651 8:58283527-58283549 ACTTTCCTCAGGAGAGCATGTGG - Intergenic
1042236589 8:66619339-66619361 AGATACCCCAGGTGACCATGTGG + Intergenic
1043095729 8:75969289-75969311 AATTCCCTGAGGTTTCCATGGGG - Intergenic
1048042114 8:130741048-130741070 AATTACCTGATGGGAACATGAGG - Intergenic
1050916992 9:11148881-11148903 AATTACCTTTGGTGACTAAGAGG + Intergenic
1051356116 9:16240873-16240895 AACAACAGCAGGTGACCATGGGG - Intronic
1052775277 9:32726888-32726910 AATTACCTCTGTTTACTATGTGG - Intergenic
1056685502 9:88755697-88755719 AATTCCCACAGGTGACCAAATGG - Intergenic
1058760120 9:108122462-108122484 ATTTACATGAGGTGAGCATGAGG + Intergenic
1191184941 X:57600260-57600282 AATTATCCTAGGTGACAATGTGG - Intergenic
1192634404 X:72804177-72804199 AATTACCTCAGGTGACCATGGGG + Intronic
1192647306 X:72916624-72916646 AATTACCTCAGGTGACCATGGGG - Intronic
1192755933 X:74047146-74047168 AATTAAGTCAGGTGACTCTGGGG + Intergenic
1195470928 X:105229328-105229350 TATCACCTCAGGTGACCTGGGGG - Intronic
1196258611 X:113552068-113552090 AATTGGCTCATGTGATCATGAGG - Intergenic
1196961655 X:121009673-121009695 AATTAACTCAGTTTATCATGGGG - Intergenic
1197772857 X:130100483-130100505 TGTTCCCTCAGGGGACCATGAGG - Intronic
1199475868 X:148244510-148244532 AAATATCTAAGGTGACCCTGGGG + Intergenic
1199872016 X:151906921-151906943 AATTGTCTCAGGTGATTATGAGG + Intergenic
1199895699 X:152125728-152125750 AATTGTCTCAGGTGACTATGAGG - Intergenic
1199949250 X:152693340-152693362 AATTATCTCATGTGATTATGAGG + Intergenic
1199960426 X:152775109-152775131 AATTATCTCATGTGATTATGAGG - Intergenic