ID: 1192642415

View in Genome Browser
Species Human (GRCh38)
Location X:72873553-72873575
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 2, 1: 0, 2: 1, 3: 26, 4: 263}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192642399_1192642415 25 Left 1192642399 X:72873505-72873527 CCCAGCTATTCCCACCCTGTATT 0: 2
1: 0
2: 0
3: 9
4: 145
Right 1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG 0: 2
1: 0
2: 1
3: 26
4: 263
1192642405_1192642415 11 Left 1192642405 X:72873519-72873541 CCCTGTATTCTCCTTTCAGGGAG 0: 2
1: 0
2: 0
3: 23
4: 188
Right 1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG 0: 2
1: 0
2: 1
3: 26
4: 263
1192642401_1192642415 15 Left 1192642401 X:72873515-72873537 CCCACCCTGTATTCTCCTTTCAG 0: 2
1: 0
2: 3
3: 23
4: 302
Right 1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG 0: 2
1: 0
2: 1
3: 26
4: 263
1192642406_1192642415 10 Left 1192642406 X:72873520-72873542 CCTGTATTCTCCTTTCAGGGAGC 0: 2
1: 0
2: 3
3: 17
4: 122
Right 1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG 0: 2
1: 0
2: 1
3: 26
4: 263
1192642400_1192642415 24 Left 1192642400 X:72873506-72873528 CCAGCTATTCCCACCCTGTATTC 0: 2
1: 0
2: 0
3: 12
4: 165
Right 1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG 0: 2
1: 0
2: 1
3: 26
4: 263
1192642398_1192642415 26 Left 1192642398 X:72873504-72873526 CCCCAGCTATTCCCACCCTGTAT 0: 2
1: 0
2: 0
3: 8
4: 159
Right 1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG 0: 2
1: 0
2: 1
3: 26
4: 263
1192642408_1192642415 0 Left 1192642408 X:72873530-72873552 CCTTTCAGGGAGCAGGCTACCTG 0: 2
1: 0
2: 1
3: 17
4: 110
Right 1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG 0: 2
1: 0
2: 1
3: 26
4: 263
1192642402_1192642415 14 Left 1192642402 X:72873516-72873538 CCACCCTGTATTCTCCTTTCAGG 0: 2
1: 0
2: 1
3: 12
4: 226
Right 1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG 0: 2
1: 0
2: 1
3: 26
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900143912 1:1149908-1149930 GTGGGCTGCAAGGCTGGCAATGG + Intergenic
900564023 1:3323610-3323632 GTGGGTTTCCAGGCGGGAGCTGG - Intronic
901032398 1:6314891-6314913 GTGGGTTGAAGGGCTCGTGGAGG - Intronic
901159354 1:7163277-7163299 GTGGGTGGCCAGGCTGGGGTGGG + Intronic
901687223 1:10949632-10949654 GTGCGTCGGAAGGCCGGTGCAGG + Exonic
902748244 1:18487915-18487937 GTCGGAGGCAAGGCTGATGCTGG - Intergenic
903362610 1:22786324-22786346 GTGAGCTGCAATGGTGGTGCTGG + Intronic
903387400 1:22936493-22936515 GAGGGGTCCAAGGCTGGGGCTGG - Intergenic
903938563 1:26913364-26913386 GTGGGGGGCAAGGCTGAAGCAGG - Intronic
904757698 1:32777678-32777700 GTGCTTTGCAAGGCTGAGGCGGG + Intronic
905323267 1:37132499-37132521 GTGGGCTGCCAGGCTGGGTCAGG - Intergenic
906195860 1:43930488-43930510 CTGGGCAGCAAGGCTGCTGCCGG + Exonic
907406280 1:54255392-54255414 CTGGGTGGGAAGGCTGCTGCTGG + Intronic
911102550 1:94105887-94105909 GGGGGTGGCGGGGCTGGTGCTGG - Intronic
912869447 1:113290712-113290734 GTGGGTAGATAGGCTGGTGAGGG - Intergenic
915080075 1:153345912-153345934 TTGGGATGGAAGGCTGGTGCTGG - Intronic
915268326 1:154734175-154734197 CTGGGTGGCAGGGCTGGTGAAGG + Intronic
917100168 1:171437390-171437412 GTGGGAGGCAAAGCTGGAGCAGG + Intergenic
918878711 1:190084933-190084955 GTGGGGTCCAACGCTGGGGCAGG + Intergenic
920194309 1:204216815-204216837 GTGGGTTCCATGGCTGGGGGTGG - Intergenic
920844842 1:209585038-209585060 TGGGGTTGCAAAGCTGGTGATGG + Intronic
921304111 1:213778868-213778890 GTGGGGTGGAAGCCTGGTGGGGG - Intergenic
922030035 1:221789036-221789058 TTGGGGTGCAAGGCAGGAGCTGG - Intergenic
922605784 1:226889054-226889076 GTGGGCAGCAAGGCTGGTGGGGG + Intronic
923534805 1:234840947-234840969 GTGGGTTGGAAGTGTGGTGGGGG - Intergenic
923668041 1:236015871-236015893 CTGGGATGCAAGACAGGTGCTGG - Intronic
924626864 1:245702717-245702739 GTTGGTGGCAAGTCTGGAGCGGG + Exonic
924728580 1:246692187-246692209 GTGGGTTTCAGGGCTGGGACGGG + Intergenic
1066568168 10:36742442-36742464 GTGGCTCGGAAGGCTGGGGCAGG + Intergenic
1068553460 10:58431933-58431955 CTGGGTGGGAAGGCAGGTGCGGG + Intergenic
1071744695 10:88403786-88403808 GTGCTTTGCAAGGCCGATGCAGG + Intronic
1072197695 10:93130704-93130726 GTGGGATGTAAGCCTGGGGCTGG - Intergenic
1072295181 10:94002220-94002242 CTGTGTTGCACTGCTGGTGCAGG - Intronic
1073518979 10:104107486-104107508 GTGTTTTGCAAGGCTGAGGCAGG - Intergenic
1074702992 10:116108739-116108761 GTGGGCAGCAAGGCTGAAGCTGG - Intronic
1075266395 10:121002584-121002606 GTCTGTTGCAAGGCTGTTGTAGG - Intergenic
1076030082 10:127149866-127149888 GTGGGTTGTAATGGTGGTGTAGG + Intronic
1076753373 10:132554915-132554937 GTGGGTGGCATGGTTGGTGTGGG + Intronic
1076753411 10:132555092-132555114 GTGGGTGGCATGGCTGCTGTGGG + Intronic
1076776172 10:132699424-132699446 GTGGGTGGCTGGGCTGGTCCAGG + Intronic
1077278926 11:1733242-1733264 GCGGGCTGCGAGGCTGATGCGGG - Exonic
1077369754 11:2175979-2176001 GTGGTGGGCAAGGCTGGTGCTGG - Intergenic
1078926598 11:15880814-15880836 GGGGGTTCCAAGGCTGGCGCTGG - Intergenic
1080451638 11:32383105-32383127 GTGCGTTCACAGGCTGGTGCAGG + Intergenic
1082097109 11:48139777-48139799 GTGGGCTACAAGGCAGGGGCTGG + Intronic
1082835984 11:57650212-57650234 GGAGGTGGCAAGGCTGGTGAAGG + Intronic
1083431049 11:62613594-62613616 GTGGCTGGCACGGCTGGTGGGGG + Exonic
1084163532 11:67364388-67364410 GTGGGTTGCCAGGCTGGGGAGGG - Exonic
1084315166 11:68341634-68341656 GGGGGTAGCATGGCGGGTGCTGG - Intronic
1087194505 11:95292174-95292196 TTGGTCTGCAAGGCTGGCGCTGG + Intergenic
1088489320 11:110371473-110371495 GTGGGGTGCAGGGCTGGCACTGG - Intergenic
1089460159 11:118648340-118648362 GTGGGTTGTAAGGATGTGGCAGG + Intronic
1089600445 11:119611220-119611242 GTGGGCTAAAAGGATGGTGCAGG + Intergenic
1091285395 11:134405850-134405872 ATTGGTAGCCAGGCTGGTGCTGG - Intronic
1091672716 12:2464207-2464229 GTGTCTTCCAAGGCTAGTGCTGG - Intronic
1092587116 12:9911006-9911028 GTGTGCTGCATGGCTGATGCAGG - Intronic
1092941260 12:13409335-13409357 GATGGTTTCAAGGCTGCTGCTGG + Intergenic
1094240246 12:28213891-28213913 GTGCCTTGAAAGGCTGGTGCAGG + Intronic
1096603303 12:52746028-52746050 GTGCTTTGGAAGGCTGGGGCAGG - Intergenic
1097248001 12:57617144-57617166 GTGGGTGGGAGGGCTGGGGCAGG + Exonic
1098776883 12:74631608-74631630 CTAGGATGCAAGGCTGGTTCAGG + Intergenic
1100199926 12:92287491-92287513 GTGGGTTGGGAGGCTGAGGCGGG + Intergenic
1101961559 12:109254581-109254603 GTGGGGTGCAATGGTGGTCCTGG + Intronic
1102025040 12:109709655-109709677 GTGGGGTGGGAGGCTGGAGCAGG + Intergenic
1102162581 12:110781696-110781718 GTGGGTGGCAAGGATGGCCCAGG - Intergenic
1102227286 12:111237718-111237740 GTGGGCAGCAAGGCAGGGGCTGG - Intronic
1102733327 12:115134563-115134585 GTGGGTGGGAAGGCTGGAACAGG + Intergenic
1103478238 12:121233831-121233853 GTGGCTTTCAGGGCTGGAGCTGG + Exonic
1103908868 12:124340893-124340915 AAGGGTTCCATGGCTGGTGCTGG - Intronic
1104444372 12:128822074-128822096 GTGAGGTGGAAGGCTGGGGCCGG - Intronic
1105426814 13:20301653-20301675 GTGGGGTGCAGGGCAGGGGCTGG + Intergenic
1112353746 13:98657517-98657539 GTGAGATGCAAGGCTGGGGTTGG + Intergenic
1112371528 13:98798082-98798104 GCTGCTTGCAAGGGTGGTGCAGG - Intronic
1112817775 13:103293211-103293233 GTGGGCTGCCAGGCTGGGGAGGG - Intergenic
1116759774 14:48997678-48997700 GTGGGATGCACTTCTGGTGCTGG + Intergenic
1117595207 14:57320269-57320291 CTGGCTTGGATGGCTGGTGCTGG + Intergenic
1117643104 14:57821740-57821762 GTAAGTTGAAAGCCTGGTGCTGG + Intronic
1118059221 14:62117110-62117132 GTGGGTTGGGAGGCTGGGGCTGG - Intergenic
1121615475 14:95310978-95311000 TTGGGTTGCAGGGCCGGAGCAGG + Intronic
1122419112 14:101564215-101564237 GTGGATTCCAGGGCTGGGGCGGG + Intergenic
1202862103 14_GL000225v1_random:89577-89599 GTCTGTGGCAGGGCTGGTGCCGG - Intergenic
1124013567 15:25858963-25858985 GTGCCTTGCAAGGGTGCTGCTGG - Intronic
1124047560 15:26164141-26164163 GTGGGTGGCAAGGAAGGTGGTGG + Intergenic
1125913543 15:43463891-43463913 GGGGGTTGGGAGGCAGGTGCAGG - Intronic
1126675670 15:51157756-51157778 GTGGGAGGCAGGGCTGGGGCTGG + Intergenic
1127771991 15:62239817-62239839 GTTGGGTGCAAGGCTGGGGTGGG + Intergenic
1127811169 15:62566797-62566819 GTGCTTTGAAAGGCTGGGGCAGG - Intronic
1128576507 15:68779695-68779717 GTTGGTTGGAAGGCTGTGGCTGG - Exonic
1128658066 15:69477107-69477129 GAGGGTTGCAAGCCTGGCACCGG + Intergenic
1129187888 15:73921633-73921655 GTGGGTGCCCAGGCTGGTGGGGG - Intergenic
1129663854 15:77568367-77568389 GTCAGTGGCAAGGCTGGTCCTGG - Intergenic
1131094146 15:89645491-89645513 GGGGGTGGCTAGGCTGGGGCAGG - Intronic
1132089926 15:98939886-98939908 CTGGGTTTCACGGCTGGGGCTGG + Intronic
1133435123 16:5772611-5772633 GTGAGTTGAAAGGATGGTGGCGG + Intergenic
1135495437 16:22947797-22947819 GTTGGGTGCAGGGCTGATGCTGG + Intergenic
1135525682 16:23212163-23212185 GGGGCATGCAAGGCTGGAGCTGG - Intronic
1137589849 16:49686892-49686914 TGGGGATGCGAGGCTGGTGCAGG - Intronic
1137606083 16:49787738-49787760 GTGGCGTGCAAGGAGGGTGCTGG - Intronic
1137910055 16:52368816-52368838 ATGGGTTGCAAGGGTGGTGAAGG - Intergenic
1138390993 16:56669733-56669755 GTCGGGTGCAAGGGTGGGGCAGG + Intronic
1138591635 16:58002352-58002374 GTGTGTTTCCAGCCTGGTGCTGG - Intronic
1138792973 16:59929982-59930004 CTGAGTTGCAAGGCTGCTTCAGG + Intergenic
1139803840 16:69546782-69546804 GTGGGTTGAAATGTTTGTGCTGG - Intergenic
1140219679 16:73034556-73034578 GTGGGTTGCTAGTTTGGGGCAGG - Intronic
1140544888 16:75797978-75798000 TTGGTTTCCAAGGCTGCTGCTGG + Intergenic
1141723528 16:85770686-85770708 GTGTGTGGCAAGGCACGTGCAGG + Intergenic
1141763737 16:86045384-86045406 GAGGGCTGCATGGCTTGTGCTGG + Intergenic
1142907120 17:3051259-3051281 GTGGGTTGCTTGCCTGGTGGTGG + Intergenic
1142927448 17:3252997-3253019 GTGGGTTGCTTGCCTGGTGGTGG - Intergenic
1142928290 17:3260079-3260101 GTGGGACTCAAGGCTGGAGCAGG - Intergenic
1143487034 17:7260970-7260992 GTGGCCTGCAAGGCCGCTGCGGG + Exonic
1144956687 17:19022175-19022197 GTGGGTTGCAGGGCTTCTGAAGG - Intronic
1145052648 17:19675484-19675506 TTGTGTTGCAAGGCTGGTTGTGG + Intronic
1145272181 17:21410578-21410600 GTGGGTTGGAGTGCTGGTGAGGG + Intronic
1145310388 17:21698043-21698065 GTGGGTTGGAGTGCTGGTGAGGG + Intronic
1146901721 17:36593113-36593135 CTGGGCTCCAAGGCTGGGGCTGG - Intronic
1148128523 17:45248762-45248784 GTGAGGGGCAAGGCTGGTGGAGG - Intergenic
1148215212 17:45830406-45830428 TGGGGTGGCAGGGCTGGTGCAGG + Exonic
1148456332 17:47813406-47813428 GTGGGGGGCAAGGAAGGTGCAGG + Intronic
1148645915 17:49219685-49219707 GTGGGTGGCGAGGCTGGGGGAGG - Intronic
1148801149 17:50226816-50226838 GTTGGTTTCAAGGCTGGGGCAGG + Intergenic
1150183483 17:63153634-63153656 TTGGGTTACAGGGCTGCTGCAGG + Intronic
1150752123 17:67873916-67873938 GTGGATTGTAGGGCTGGGGCAGG + Intronic
1151356239 17:73560269-73560291 CTGGGCTGCAGGGCTGGAGCTGG + Intronic
1151386359 17:73757754-73757776 GTGGGGTGGGAGGCTGGTGGAGG - Intergenic
1151851306 17:76691637-76691659 GTTGGTTGCAGGGGTGGGGCTGG + Intronic
1156591237 18:38490967-38490989 GTCAGTGGCAAGGATGGTGCTGG - Intergenic
1159965179 18:74588016-74588038 GGGGGTTGTAAGGGTGTTGCTGG - Intergenic
1160063011 18:75549451-75549473 GTAGCTAGCAAGGCTGGAGCAGG - Intergenic
1160505718 18:79425927-79425949 GTGAGCTGCCACGCTGGTGCAGG - Intronic
1160854658 19:1211340-1211362 GTGGGTTCCTAGGGTGGAGCAGG + Intronic
1164074388 19:21800801-21800823 CTGGGTTGCAATGCTGGGACAGG - Intergenic
1165161924 19:33821288-33821310 GTGGCTAGCCAGGCTGGGGCTGG - Intergenic
1165790205 19:38486801-38486823 GTGGATGGAAAGGCTGGTGGAGG - Intronic
1165968469 19:39604818-39604840 GTGGGTCTCATGCCTGGTGCTGG - Intronic
1166128873 19:40733464-40733486 GTGGGATGAAAGGCTGGGGCTGG + Intronic
1166434813 19:42758409-42758431 GTGTGTTGCAAGACAGATGCAGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166959410 19:46488736-46488758 GCAGGGTGCAAGGCTGGAGCAGG - Intronic
926502683 2:13675228-13675250 GTGGGCTGCTTGGTTGGTGCTGG + Intergenic
927433616 2:23047974-23047996 GTGGGATGGAAGGCTGGAGGTGG + Intergenic
927963811 2:27257115-27257137 GTGGGGAGGAAGGCTGGGGCAGG + Intronic
928542570 2:32297095-32297117 GTTGATTCCAAGGCTGGGGCAGG - Intronic
929306838 2:40372982-40373004 GGGGATTGCAAGGCTGCTGTTGG - Intronic
930769994 2:55121070-55121092 GTGGGATTCAAGGCTGATTCTGG - Intergenic
932875947 2:75452161-75452183 GTTGATTGCAAGGCTGGGGAAGG - Intergenic
937108282 2:119339697-119339719 CTGGGTTCCAAGCCAGGTGCTGG - Intronic
937872042 2:126792866-126792888 CTGGGTGCCAAGGATGGTGCAGG + Intergenic
938115044 2:128596936-128596958 GCAGGTTGCAAGGCTGGAGAAGG - Intergenic
938500357 2:131828978-131829000 CTGGGCTGCTACGCTGGTGCGGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
938730543 2:134143625-134143647 GAGGGGTGGAAGGGTGGTGCTGG + Intronic
940573769 2:155472879-155472901 GTGGGTTGCGGGGCTGGGGAGGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
945056464 2:205873592-205873614 GTGAGTGGCAAGACTGGAGCAGG + Intergenic
947860033 2:233352295-233352317 GCCGGTAGCAAGGCGGGTGCGGG - Intergenic
948225943 2:236309477-236309499 GTGGGTGGGAAGGCAGGGGCAGG + Intergenic
948909034 2:240993837-240993859 TTGGGTTGCACAGCTGGTGGGGG - Intergenic
1169497996 20:6133217-6133239 GTGGGTTGGTGGGTTGGTGCTGG - Intergenic
1170870529 20:20201871-20201893 GTGGGTGGCCTGGCTGGAGCTGG + Intronic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1174789575 20:53464876-53464898 GTGACTTGCAAGGCTGAGGCAGG - Intronic
1175659728 20:60802349-60802371 CTGGGACGTAAGGCTGGTGCAGG - Intergenic
1178624297 21:34202522-34202544 CTGGGTTGAAAGCCTGGTGGAGG - Intergenic
1179488643 21:41726747-41726769 GTGGCCTGCAGGGCTGGTGAAGG + Intergenic
1181045403 22:20211865-20211887 GGGGCTTCCTAGGCTGGTGCTGG + Intergenic
1181563013 22:23716684-23716706 GTAACTTGCAAGGCTGGGGCGGG + Intergenic
1182085242 22:27556734-27556756 GCTGGTTGCAAGGTTGGTACCGG + Intergenic
1182096336 22:27628488-27628510 ATGTCTTGCAAGGCTGGAGCAGG - Intergenic
1183978463 22:41526498-41526520 GGGGCCTGCAAGGCAGGTGCAGG + Exonic
1185271821 22:49933368-49933390 ATGAGTTGCAGGGCTGGAGCGGG - Intergenic
1185393083 22:50573146-50573168 GTGGGGTGCCAGGCTGGACCTGG + Intronic
950966710 3:17151856-17151878 GTGCGTGGCAAGGCTGCCGCTGG - Intergenic
951579559 3:24147920-24147942 CTGGGTTGCAAGGGAGGTGGGGG - Intronic
952254055 3:31680438-31680460 GGGGGATGCAGGGCAGGTGCTGG - Intronic
953722321 3:45367222-45367244 GTGCTTTGGAAGGCTGATGCGGG - Intergenic
954198993 3:49013122-49013144 GTGGGAGGCAAGGCTCGGGCTGG + Exonic
957333677 3:78799072-78799094 GTGGGTTCCAATGATGGTCCTGG + Intronic
958433647 3:94071896-94071918 GTGGGTTGCTAACCTGGGGCTGG - Intronic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
962422513 3:135240874-135240896 GTGGGTTCCAATGTTGCTGCAGG - Intronic
963008471 3:140748411-140748433 GTGGGCTCCAAGACTGGTTCTGG - Intergenic
963102474 3:141620485-141620507 GTGGGGTCTGAGGCTGGTGCAGG - Intergenic
964423891 3:156532259-156532281 GTGGGTTGAAAGGATGTTCCTGG + Intronic
964728447 3:159839684-159839706 GTGGGTAGGAAGGATGATGCCGG + Intronic
965806811 3:172550619-172550641 GTGGGTGGCAAGGTTGGGGGTGG + Intergenic
968764070 4:2459052-2459074 GTGGGTGGCAGGGCAGGGGCTGG - Intronic
968971195 4:3796120-3796142 GAGGTTTGCCAGGCTGGAGCTGG - Intergenic
969538326 4:7770236-7770258 GGGGGTGGCAAGGCAGGAGCTGG + Intronic
969732136 4:8963756-8963778 GCGGGATGCAGGGCTGGCGCGGG - Intergenic
969791729 4:9497841-9497863 GCGGGATGCAGGGCTGGCGCGGG - Intergenic
973329383 4:48896969-48896991 GTGAGATGCAAGGCAGCTGCTGG + Intronic
975754849 4:77562134-77562156 GGGGGTGGGAAGGCTTGTGCCGG - Intronic
976648456 4:87409876-87409898 GTGGGCTGGAAGGCTAGTGGGGG - Intergenic
982910634 4:161137565-161137587 GTAGTTTCCAAGGCTGGTGATGG - Intergenic
984999673 4:185471249-185471271 GCGGGTTTGAAGGCTGGGGCGGG + Intronic
985014801 4:185623049-185623071 GTGGGTGGAGAGGCTGGTGCAGG + Exonic
985662548 5:1164331-1164353 GTGGGTGGGAAGGATGGTGTGGG + Intergenic
985878223 5:2617303-2617325 GTGTGTTGGACTGCTGGTGCTGG - Intergenic
986315397 5:6583331-6583353 TGGGGTTCCAGGGCTGGTGCTGG - Intergenic
986602913 5:9491438-9491460 GTGGGTTGTGTGGCTGGTGGGGG - Intronic
992826489 5:80554587-80554609 GTTGGTGGCAAGGATGGTGGGGG + Intergenic
992915109 5:81441886-81441908 ATGGGTTGAAAAACTGGTGCTGG + Intronic
994592708 5:101791953-101791975 GTGGTTTGAAAGGATGGTCCTGG - Intergenic
996949537 5:129109229-129109251 GTGGGTTTGAAGGCAGGTTCTGG + Intronic
997098892 5:130946014-130946036 ATAGGTTCCAAGGCTTGTGCTGG + Intergenic
997660084 5:135582668-135582690 GTGGGGAGCATGGCAGGTGCTGG - Intergenic
1002001186 5:176197032-176197054 GTGGGTTGCAAGGCAGGCCCTGG + Intergenic
1002649329 5:180680221-180680243 GTGGGGTGCAAGGCAGGCCCTGG - Intergenic
1002835478 6:861647-861669 GGGGGTTGAGAGGCTGGTCCAGG - Intergenic
1003096161 6:3145055-3145077 GTGGGTTGGAGTGCTGGTGTGGG + Intronic
1003096164 6:3145073-3145095 GTGGGTTGCAGTGCTGGTTTGGG + Intronic
1003096209 6:3145269-3145291 GTGGGTTGGAGTGCTGGTTCGGG + Intronic
1003096232 6:3145359-3145381 GTGGGTTGGAGTGCTGGTTCGGG + Intronic
1003096278 6:3145556-3145578 GTGGGTTGGAGTGCTGGTGTGGG + Intronic
1003096385 6:3146087-3146109 GTGGGTTGGAGTGCTGGTTCCGG + Intronic
1003096416 6:3146213-3146235 GTGGGTTGGAGTGCTGGTTCTGG + Intronic
1003523404 6:6878162-6878184 GTGGGGTGCGGGGCTGGGGCAGG + Intergenic
1006242149 6:32692199-32692221 GGGCGTTGCAAGCCTGGTGGAGG - Intergenic
1010297504 6:74217459-74217481 GTGGGGTGCGAGGCTGGGGGAGG - Intergenic
1010927417 6:81760080-81760102 GTGGGTTACAAGGCTTGTCGAGG + Intergenic
1010985028 6:82413713-82413735 GAGGGGTCCCAGGCTGGTGCAGG + Intergenic
1013269046 6:108528670-108528692 GAGAGTTGCAAGGTTGGGGCTGG - Intergenic
1013274327 6:108569778-108569800 GTAGGGGGCAAGGCTGGAGCAGG + Intronic
1014536444 6:122619500-122619522 GTAAGTTCCAAGGCAGGTGCGGG - Intronic
1015634247 6:135260532-135260554 GGGGGCTGCAAGGCAGGGGCTGG - Intergenic
1016870081 6:148808030-148808052 GTGGGAGGCAGGGCTGGGGCTGG + Intronic
1018102979 6:160457678-160457700 GTGGGCTGCAGGGCTGTTACAGG - Intergenic
1018754526 6:166837608-166837630 CTGGGGTCCTAGGCTGGTGCTGG + Intronic
1022024792 7:26437415-26437437 ATGGGATGCAAGGCTGGCGATGG + Intergenic
1023177479 7:37448276-37448298 GAGGGTTGCGACGCTGGCGCGGG - Intronic
1023609307 7:41957489-41957511 GTGGCATGCAAGGAGGGTGCTGG - Intergenic
1024956352 7:54925483-54925505 GTGGGTTGCGAGGCAGGGGGAGG + Intergenic
1025799671 7:64774074-64774096 CTGGGTTACAAGGATGCTGCTGG + Intergenic
1028475284 7:91246909-91246931 GTGGGGAGCTTGGCTGGTGCTGG + Intergenic
1029151068 7:98480910-98480932 GTGGGTGGCTGGGCTGGGGCAGG - Intergenic
1029214123 7:98933279-98933301 GTGCGTTGGCAGGCTGGTGTCGG - Exonic
1029578672 7:101420640-101420662 GTGAGGGGCAAGGCTGGTGGGGG - Intronic
1029732357 7:102446821-102446843 GTGGGGGGCCAGGCTGGCGCCGG - Exonic
1031351852 7:120742544-120742566 CTGGGTTTCAAAGCTGGAGCCGG - Exonic
1032780974 7:135165090-135165112 GTGGGTTCCATCGCTGGAGCTGG - Exonic
1034959477 7:155355996-155356018 GTGAGGGGCAAGGCTGGTCCTGG + Intergenic
1035010407 7:155710809-155710831 GGGGGATGCAAGGCTGCTACAGG + Intronic
1036769551 8:11569622-11569644 GTGGGTTGCCAGGCTGGGGGCGG - Intergenic
1037839580 8:22234175-22234197 GTGGGAGGCAGGGATGGTGCTGG - Intergenic
1038032837 8:23659718-23659740 GTGTTTTGGAAGGCTGATGCAGG + Intergenic
1039916782 8:41865863-41865885 GTGGCTTTGAAGACTGGTGCAGG - Intronic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1041101289 8:54398656-54398678 GAGGGATGTAAGGCTGGAGCAGG - Intergenic
1041348907 8:56929465-56929487 GTGGGATGCTAGGCTGGGGACGG - Intergenic
1043761558 8:84075435-84075457 GTGGTTTTGTAGGCTGGTGCAGG - Intergenic
1047242034 8:123099504-123099526 GTGAGTTGCAAGGGTAGTGGAGG - Intronic
1047312717 8:123706116-123706138 GTGAGTTGCCTGCCTGGTGCTGG + Intronic
1047451237 8:124966839-124966861 GTAAGTTGCCAGGCTGGTCCCGG + Intergenic
1048305990 8:133285135-133285157 CTGGGGTGCAAGGCTTGGGCAGG + Intronic
1049332744 8:142063833-142063855 GGGGGTTCCCAGGCTGCTGCCGG - Intergenic
1049405860 8:142451604-142451626 GTGGGTTCCCAGGATGGAGCGGG - Intronic
1049471762 8:142777865-142777887 TGGGGCCGCAAGGCTGGTGCCGG - Exonic
1049562495 8:143318692-143318714 GAGGGCTGCCATGCTGGTGCTGG - Intronic
1049567351 8:143348018-143348040 CTGGCTTGCAAGGCTGCTGTGGG - Intronic
1049662096 8:143824117-143824139 GGAGGGTGCAGGGCTGGTGCGGG + Intronic
1049748406 8:144272639-144272661 GTGGGCTGCAAGGGTGGTGGGGG - Intronic
1049782697 8:144436057-144436079 GTAGGCTGCCCGGCTGGTGCTGG + Exonic
1050794739 9:9524066-9524088 GTGGGTTTCTAGGCTGGGGAAGG + Intronic
1051323433 9:15936540-15936562 GTGGGATGCAAGGCTGGTCAAGG + Intronic
1051612107 9:18971070-18971092 TTGGGTAGGAGGGCTGGTGCAGG - Intronic
1052250688 9:26394011-26394033 GTAGGTTTCTTGGCTGGTGCTGG - Intergenic
1053351187 9:37414405-37414427 GTGGGGTGCAAGGCTGCAGCAGG + Intergenic
1055763602 9:79637070-79637092 GTAGAATGCAAGGCTGGAGCTGG + Intronic
1059304072 9:113340219-113340241 GTGGGCTGCGGGGCTGGAGCTGG + Exonic
1059671911 9:116499952-116499974 GTGGGTTGCAAGACTGAATCAGG - Intronic
1061595854 9:131628649-131628671 TTGGGTGGCAATGCTGGTGGAGG + Exonic
1062389728 9:136329180-136329202 GGGGGATGCAAGGCTGGGTCTGG - Intronic
1062522469 9:136963987-136964009 GTGGGCTGCAGGGCTGGGGCTGG + Intergenic
1186437868 X:9558632-9558654 TTGGGTTGTAAGGCTGGACCTGG + Intronic
1188505166 X:30874610-30874632 GTGAGTAGCAAGGATGTTGCTGG + Intronic
1188897231 X:35684405-35684427 GTGGGTCGCAAGTCTTATGCAGG - Intergenic
1190512057 X:51182948-51182970 CTGGTTAGCCAGGCTGGTGCTGG - Intergenic
1191601967 X:63018299-63018321 GTGGGCAGCAAGGCTGGGGGAGG + Intergenic
1192169153 X:68843659-68843681 ATGGGTGCCATGGCTGGTGCTGG + Intergenic
1192639296 X:72847252-72847274 GTGGGTTGCAAGGCTGGTGCAGG - Exonic
1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG + Exonic
1193031777 X:76906692-76906714 CTGGGTTGCCAGGCTGGCTCTGG - Intergenic
1196270194 X:113700498-113700520 GTGCATTACAAGGCTGCTGCTGG + Intergenic
1197375875 X:125681691-125681713 TTGTGCTGCAAGGCTGCTGCTGG - Intergenic
1198255849 X:134923921-134923943 GTGGGTTGGAAGGCTGAGGCAGG - Intergenic
1200985703 Y:9302523-9302545 GTGGGTTGCGGGGCTGGGGAGGG - Intergenic