ID: 1192647309

View in Genome Browser
Species Human (GRCh38)
Location X:72916635-72916657
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192647309_1192647311 1 Left 1192647309 X:72916635-72916657 CCTGAGGTAATTCTACAGACTGC 0: 2
1: 0
2: 0
3: 5
4: 82
Right 1192647311 X:72916659-72916681 AGAGTACTCCTGAGAACAGTCGG 0: 2
1: 0
2: 0
3: 13
4: 142
1192647309_1192647313 12 Left 1192647309 X:72916635-72916657 CCTGAGGTAATTCTACAGACTGC 0: 2
1: 0
2: 0
3: 5
4: 82
Right 1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG 0: 2
1: 1
2: 0
3: 9
4: 113
1192647309_1192647314 29 Left 1192647309 X:72916635-72916657 CCTGAGGTAATTCTACAGACTGC 0: 2
1: 0
2: 0
3: 5
4: 82
Right 1192647314 X:72916687-72916709 TGCTGGTGTCCTACAGAAGATGG 0: 2
1: 0
2: 0
3: 28
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192647309 Original CRISPR GCAGTCTGTAGAATTACCTC AGG (reversed) Intronic
903567977 1:24283442-24283464 GCAATTTGTACAATTACCCCGGG - Intergenic
904413599 1:30341330-30341352 GCAGTCTTTAGGATGAGCTCAGG - Intergenic
909631081 1:77770639-77770661 GCAGTCCCCAGAAATACCTCAGG - Intergenic
910363730 1:86441490-86441512 GCTTTCAGTAGAATTTCCTCTGG + Exonic
911249689 1:95560728-95560750 GAATTCTGTAGAATTTGCTCAGG - Intergenic
914942491 1:152035547-152035569 TCACTTTGGAGAATTACCTCTGG - Intronic
918584847 1:186174422-186174444 GCATTCTGTAGAATTGCCAAAGG - Intronic
919586625 1:199447897-199447919 GCAGTCTGCAGCATCACTTCAGG - Intergenic
1068612729 10:59077858-59077880 GCTGTGTGTAGAATAACCTTGGG - Intergenic
1068638923 10:59380004-59380026 ACAATCTGTAGAATGACATCAGG + Intergenic
1068749603 10:60576879-60576901 GCAGTTGGTAGAATTGCTTCTGG - Intronic
1069512473 10:69052654-69052676 GCATGCTGTAGAATTTCCTTAGG + Intergenic
1069821471 10:71231161-71231183 GCAGCCTATAGAATTTCCTGAGG + Intronic
1070839165 10:79471237-79471259 GCTATCTGGAAAATTACCTCTGG - Intergenic
1074602642 10:114931030-114931052 GCAAAGTGAAGAATTACCTCTGG - Intergenic
1075008312 10:118846281-118846303 GCTGTCTGTAAAATTCCATCAGG - Intergenic
1078416339 11:11169254-11169276 GAAGTCTGTAGAATTTCCTGAGG - Intergenic
1081302626 11:41471293-41471315 GGAGTCTTTAGAATTAGCTGAGG - Intergenic
1095981397 12:47976691-47976713 GCAGTTTCTAGGATTTCCTCAGG - Intronic
1100220821 12:92503023-92503045 GCTGTCCCTAGAATCACCTCAGG - Intergenic
1107403409 13:40091097-40091119 GCAGACTGTAGTATTCACTCAGG - Intergenic
1115378789 14:32709666-32709688 GAAGGCTGTGGAATTCCCTCTGG - Intronic
1115875956 14:37862513-37862535 GCAGTAGGAAGAATTACCTTTGG + Intronic
1116361898 14:44010139-44010161 GCAGTCTGGAAAAATAACTCAGG - Intergenic
1117301049 14:54428421-54428443 GCACTCTGTAGAATTGCCCTTGG - Intronic
1125133606 15:36313968-36313990 GCAGTCTTAAAAATTACTTCTGG - Intergenic
1125846291 15:42857620-42857642 ATAGGCTGTAGAATTTCCTCAGG - Intronic
1130647339 15:85740788-85740810 GCAGTCAGTGGTATTACCTGGGG - Intronic
1136747314 16:32602238-32602260 GGAGTCTGTAGAACTTCCTCAGG + Intergenic
1203049449 16_KI270728v1_random:861444-861466 GGAGTCTGTAGAACTTCCTCAGG + Intergenic
1148565480 17:48630625-48630647 TGAGTCTGAAGAAATACCTCTGG - Intronic
1155100641 18:22607000-22607022 GCACTCTGAAGCATTGCCTCTGG + Intergenic
1155288011 18:24311303-24311325 TCAGTCTGAATAATTACGTCAGG - Intronic
1156760099 18:40578325-40578347 GCTGTCTGTAGTATTTTCTCAGG - Intergenic
1156844478 18:41648499-41648521 GCAGCCAGTAGAATTCACTCTGG + Intergenic
1158199786 18:54926903-54926925 GCAGTTTTCAGAATAACCTCAGG - Intronic
1161155001 19:2727943-2727965 GCAAGCTGGAGAATTAACTCCGG - Intronic
1164838118 19:31371700-31371722 GCTGTGTGTAGAACTAACTCAGG + Intergenic
1165931093 19:39359238-39359260 GCAGGCAGTTGGATTACCTCTGG + Intronic
933228569 2:79779422-79779444 GCAGGCAGTAGATTCACCTCAGG - Intronic
938922454 2:136007802-136007824 GCAGCCTTAACAATTACCTCTGG + Intergenic
940449446 2:153818843-153818865 CCAGTCTGTAATATTCCCTCAGG + Intergenic
1172880720 20:38198308-38198330 GCAGCCTGTAGATTGGCCTCGGG - Intergenic
1173079774 20:39854605-39854627 TCAGACTGTAGAATTACCAAGGG - Intergenic
1173526025 20:43733340-43733362 CCAGTCTGTAGTATTTCCTTAGG + Intergenic
1174118395 20:48243708-48243730 GCCATCTGTAGAATTACCTGAGG - Intergenic
954427735 3:50452208-50452230 GCTGTCTGTGGAATTGGCTCAGG + Intronic
955474331 3:59320290-59320312 ACAGTTTGTAGAACTGCCTCTGG + Intergenic
956734486 3:72227754-72227776 GCAGAGTGTAGAATTACTTCTGG + Intergenic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
964503109 3:157369992-157370014 GATTTCTGTAAAATTACCTCTGG - Intronic
971993357 4:33930798-33930820 GCAGAATTTGGAATTACCTCTGG + Intergenic
972752370 4:42004533-42004555 GCATTCTGTATTATTTCCTCAGG + Intronic
974816201 4:67006975-67006997 GTATTCTGAAGAATGACCTCTGG + Intergenic
975706763 4:77119716-77119738 GCATTCTATATAATTTCCTCAGG + Intergenic
977763664 4:100771956-100771978 GCAATATGTAGATTTACTTCTGG - Intronic
981164788 4:141544908-141544930 GAAGTCTGTAGAATGATCTATGG - Intergenic
985188601 4:187346094-187346116 GCAGACTGCAGAATAACCACAGG - Intergenic
994890145 5:105623071-105623093 GCACTCAGGAGAATTACCTGAGG - Intergenic
997043774 5:130289249-130289271 GCACTCTGGGGAATTACCTGGGG - Intergenic
1004790050 6:19015424-19015446 ACATTCTGTAGAATAACATCTGG + Intergenic
1009910057 6:69914741-69914763 GCTGGTTGAAGAATTACCTCCGG + Intronic
1016979059 6:149837645-149837667 GGAGTCTGAAGAATTAAGTCGGG - Intronic
1019583952 7:1786093-1786115 GCAGTCTGTGGATTTTCCGCAGG + Intergenic
1022195789 7:28066214-28066236 GCAGTTCTTAGAAATACCTCTGG - Intronic
1023256519 7:38318086-38318108 GCAGTTTGTAAAAATACCTTGGG - Intergenic
1023529935 7:41142361-41142383 GTAGTCTGTAGAATATCCTTTGG + Intergenic
1028657273 7:93222988-93223010 GAAGTCTGTATAATTGCCTTGGG + Intronic
1030023283 7:105296949-105296971 GCAGTATGTATAGTTGCCTCTGG - Intronic
1035392347 7:158513258-158513280 TCAGTCTGTAGAATGTCCCCTGG - Intronic
1037640623 8:20738992-20739014 GCTTTCTGTAGAAATACCTTAGG + Intergenic
1038164177 8:25068768-25068790 ACCATCTGTAGAATTACCTAAGG + Intergenic
1042700805 8:71611982-71612004 ACAGTCTGTAGAATAACTTTGGG - Intergenic
1045250091 8:100475733-100475755 GCAGGCTGAAGAGTTACCTAAGG + Intergenic
1046194023 8:110835316-110835338 GTTGTCTGTGGAATTACCTGTGG + Intergenic
1047021185 8:120776448-120776470 GGAGTCTGTAGAAATGGCTCAGG - Intronic
1055392705 9:75840362-75840384 ACAGTATGTAGAATTGCTTCAGG + Intergenic
1055469141 9:76594173-76594195 ACAGTCACTAGAATGACCTCTGG - Intergenic
1058342851 9:103920021-103920043 GCAGAATTCAGAATTACCTCAGG - Intergenic
1062411120 9:136425095-136425117 GCAGTTTCTAGAATGTCCTCGGG - Intergenic
1062728332 9:138092324-138092346 GCAGTCTGTAGGCCTACCCCTGG + Intronic
1186410197 X:9340139-9340161 TAAGTCTGCAGAATTACCTGGGG + Intergenic
1186843540 X:13508857-13508879 GCAGGTAGTGGAATTACCTCCGG - Intergenic
1189972073 X:46428077-46428099 GCTCTCTGTAGAATTGTCTCAGG + Intergenic
1190465578 X:50722418-50722440 GCACTCAGTAGATTTTCCTCTGG + Intronic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1200168842 X:154057314-154057336 GCAGTGGGTACAATTATCTCAGG - Intronic
1200549275 Y:4558599-4558621 GCAGTCTGGGGTATTGCCTCAGG + Intergenic