ID: 1192647973

View in Genome Browser
Species Human (GRCh38)
Location X:72922799-72922821
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 2, 1: 2, 2: 20, 3: 55, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192647972_1192647973 4 Left 1192647972 X:72922772-72922794 CCTTTTAAAAGATAAAGAAATTG 0: 2
1: 0
2: 73
3: 749
4: 4459
Right 1192647973 X:72922799-72922821 ATCTTTAGCTAGACTAACTAAGG 0: 2
1: 2
2: 20
3: 55
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900910014 1:5589417-5589439 ATCTTTAGCTGGACTAACCAAGG + Intergenic
902418357 1:16256810-16256832 ATCTATGGATAGCCTAACTACGG - Intronic
907083554 1:51647773-51647795 ATCATTAGCTAGACTGACCAAGG - Intronic
907727290 1:57031669-57031691 CTATTTAGCAAGGCTAACTAAGG - Intronic
908372637 1:63498801-63498823 ATCTTCAGCTAGACTGATGAAGG + Intronic
909010869 1:70333492-70333514 AGCTTTAGCTAGACTGACTTGGG - Intronic
909173488 1:72323840-72323862 ATCTTTTGCTAGACTTAAAAAGG - Intergenic
909271889 1:73632988-73633010 AACTTTAGCCAGACTAACTATGG + Intergenic
909476476 1:76086613-76086635 ATCGTTAGCTAGAATGTCTAAGG + Intronic
910295515 1:85641072-85641094 CTCTTTAGCAAGACTAACCAAGG + Intergenic
911646156 1:100339249-100339271 ATCTTTAGCTACATTAAAGAGGG - Intergenic
911987911 1:104654404-104654426 ATCTTTAGTCAGAATAATTAAGG - Intergenic
913431544 1:118799084-118799106 AACTTTAGCTAGGCTAACAAAGG - Intergenic
915967136 1:160320122-160320144 ACTGTTAGCTAGACCAACTAAGG + Intronic
917003974 1:170391189-170391211 ATCTTTAGCTAGATGAACTAAGG - Intergenic
917762715 1:178181081-178181103 ATCTTTAGCCAGATTAATCAAGG - Intronic
918154788 1:181834162-181834184 ACCTTTAGCTAGACTAAAAAAGG + Intergenic
918333325 1:183481466-183481488 CTCTGCAGCTAGACTAAGTATGG + Intronic
918387776 1:184027733-184027755 TTATTTAGCAAGACAAACTATGG - Intronic
918746999 1:188215432-188215454 AACTTTGGCTAGGTTAACTAAGG - Intergenic
919321082 1:196039083-196039105 AACCATAGCTAGACTTACTAAGG - Intergenic
919389287 1:196962272-196962294 ATTTTTAGCAAGAATAACGAAGG + Intergenic
920083176 1:203392182-203392204 ATCTCTAGCCAGATTAATTAGGG - Intergenic
920207212 1:204301234-204301256 ATCTTTAGCTTAAATAACTCTGG - Intronic
922017167 1:221660926-221660948 ACTTTTAGATAGACTAACCACGG - Intergenic
922888584 1:229041807-229041829 AACTTTAGCTACATTATCTAAGG + Intergenic
923100659 1:230813280-230813302 GCCTTTAGCTAGACTGACCAAGG - Intergenic
1064831506 10:19472780-19472802 ACCTTTAGCTAGACTTAGAAAGG - Intronic
1065085447 10:22170223-22170245 ATCTTTAGCTAGAATGACTAAGG + Intergenic
1066218876 10:33316030-33316052 ATTTTTAACTAGAATAAGTAGGG - Intronic
1066514296 10:36139465-36139487 ACTTTTAGCCAGAGTAACTAAGG - Intergenic
1067330671 10:45314664-45314686 ATGCTTAGCTAGATTAACTAAGG + Intronic
1068436371 10:56996436-56996458 ACCTTTAGCTAGATTAACTGAGG + Intergenic
1069487257 10:68831853-68831875 ATCTTTAGCTTGATTAACAAGGG + Intronic
1074642258 10:115399560-115399582 ACCACTAGCTAGACTAACAAAGG - Intronic
1077823711 11:5780511-5780533 ACATTTAGCTAGATTAACTGAGG + Intronic
1078472142 11:11597982-11598004 AACTTTAGATAGACTGACAAAGG - Intronic
1078703525 11:13715299-13715321 ATCTTTGGGGACACTAACTATGG + Intronic
1079687793 11:23382871-23382893 ACCATTAGCTAGACTATCCAAGG + Intergenic
1080423051 11:32129454-32129476 AACATTAGCTAGATTAACAAAGG + Intergenic
1080706934 11:34704003-34704025 ACCTTTAGCCAGACTAACAAAGG - Intergenic
1081035366 11:38137427-38137449 ATCTTTAGCTAGTTTCACTGGGG + Intergenic
1082691826 11:56314351-56314373 ATGTTTAGAGAGACTAAGTATGG + Intergenic
1085813528 11:79710025-79710047 AACTCTAGCTAGACTGATTAAGG + Intergenic
1087227788 11:95623062-95623084 ATCTTTAGCTAGTCTAAGACAGG + Intergenic
1091052216 11:132383118-132383140 ATTTTTAGCTAGAATAACTAAGG + Intergenic
1092646873 12:10584370-10584392 ATCTCTAGCTAGACTGATCAAGG + Intergenic
1093146808 12:15576143-15576165 ATCTTTATGAAGACAAACTATGG - Intronic
1093224012 12:16459416-16459438 ATGTTTATCTCTACTAACTAGGG - Intronic
1093519686 12:20033725-20033747 GTCTTTAGCGAGAATAATTAAGG - Intergenic
1094289832 12:28834873-28834895 ATCTTTAGCAAGACTCACAAGGG - Intergenic
1094311538 12:29089043-29089065 ACCTTTAGCTAGACAAAAAAAGG + Intergenic
1094579348 12:31719693-31719715 ATCTTTAGCTTTACTAGATAAGG - Intronic
1094639244 12:32257578-32257600 ATCTTTAGCTTTACTAGATAAGG - Intronic
1094756727 12:33478956-33478978 AACCTTAGCTAGACTGACTAAGG + Intergenic
1095772861 12:45981582-45981604 ATCTGTAACTAGAATAACTTGGG - Intronic
1096133186 12:49177113-49177135 AACTTGAGCTAGAGTAACAATGG - Intergenic
1097673528 12:62570684-62570706 ATTTTTTGCTGGAATAACTATGG + Intronic
1098282617 12:68876940-68876962 ATCTTCAGCTATCCTAACAATGG + Intronic
1098587921 12:72176347-72176369 ATCCATATCTAGACTAAGTAGGG - Intronic
1100114496 12:91287680-91287702 AGCTTTAACTAGATTAACTAAGG + Intergenic
1104303085 12:127583473-127583495 ATCTTTAGCTAGACCAACCAAGG - Intergenic
1108231876 13:48353194-48353216 GCCTTTAGCTAGATTAACTAAGG + Intronic
1109173477 13:59125498-59125520 ATCTATAGCTACACCAACAATGG + Intergenic
1110210571 13:72967606-72967628 TTCTTTAGCTAAAATAATTAAGG + Intronic
1112612906 13:100973966-100973988 ACTTTTAACTAGACTGACTAAGG - Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1115003632 14:28453287-28453309 ATCTTTAGTTAGACCAAGGAAGG - Intergenic
1115153181 14:30308985-30309007 ATTTTTAGCTTCACAAACTATGG - Intergenic
1115326036 14:32139601-32139623 ACCTTTAGCTAGATTTACCAAGG - Intronic
1118099170 14:62576339-62576361 AACTTTAGCCAGACTAACTTTGG + Intergenic
1120181487 14:81347169-81347191 ACCTTTAGCTAGACTAACCAAGG + Intronic
1120260917 14:82184506-82184528 TTTTTTAGTTAGACTAGCTAAGG + Intergenic
1122368316 14:101212066-101212088 ACCTTTAGCTAGACTCATCAAGG - Intergenic
1124242443 15:28040590-28040612 ATCTTTAGCTAGACTGACTAAGG + Intronic
1126243896 15:46480332-46480354 ACTTTTAGCTAGACAAACTAAGG - Intergenic
1126458215 15:48887746-48887768 ACCTTTAGCTAGATGAACTAAGG + Intronic
1132412268 15:101590993-101591015 ATCTCTAACAAGACTAACAAGGG - Intergenic
1132867220 16:2099478-2099500 AGCCTTAGCTAGACTGACCAGGG - Intronic
1133715732 16:8446826-8446848 ATCTCTAGCCAGACTTACAAGGG + Intergenic
1134524555 16:14933637-14933659 AGCCTTAGCTAGACTGACCAGGG + Intronic
1134548348 16:15127304-15127326 AGCCTTAGCTAGACTGACCAGGG - Intronic
1134712144 16:16332124-16332146 AGCCTTAGCTAGACTGACCAGGG + Intergenic
1134720001 16:16375417-16375439 AGCCTTAGCTAGACTGACCAGGG + Intergenic
1134947425 16:18336468-18336490 AGCCTTAGCTAGACTGACCAGGG - Intronic
1134954685 16:18376570-18376592 AGCCTTAGCTAGACTGACCAGGG - Intergenic
1136004214 16:27317456-27317478 ACGTTTAGCTAGACTTACCATGG + Intronic
1140184757 16:72758111-72758133 ACTTTTAGCTAGATTGACTAAGG - Intergenic
1140419199 16:74804021-74804043 ATCTTTAGCTAGACTGAAGAGGG - Intergenic
1148811429 17:50294874-50294896 ATTCTAAGCTAGACTAACTAAGG + Intergenic
1150480870 17:65508851-65508873 ACCTCTAGCTAGACTAGCCAAGG + Intergenic
1153073824 18:1138918-1138940 AACTTTAGCAAGACTAATGAAGG - Intergenic
1154373581 18:13789501-13789523 ACCTTTAGTTAGACTGACCAAGG - Intergenic
1158650906 18:59284670-59284692 TTTTTTAACTAGACTAACCAAGG + Intronic
1159436118 18:68419724-68419746 ATCTTTAACAAGAATATCTATGG - Intergenic
1159703654 18:71660528-71660550 ATATTTAGCTAGTCAAACTTAGG - Intergenic
1163707602 19:18824561-18824583 AACTTTAGCTAGATTGACCAAGG - Intergenic
1166973124 19:46584029-46584051 ATCTTTAACTAGACTAACCAAGG + Intronic
1168392051 19:56017190-56017212 ACCTTTAGCCAGACTGACCAAGG - Intronic
925534012 2:4896658-4896680 ACCACTAGCTAGACTAACCAAGG + Intergenic
926519097 2:13887254-13887276 ACCTTTAGCCAGGCTAACTAAGG + Intergenic
928503473 2:31923598-31923620 ATGTTTAGGTAGCCTGACTAGGG + Intronic
928679606 2:33687323-33687345 ACCATTAGCTAAACTAAGTAGGG - Intergenic
928847526 2:35695481-35695503 ATCTTTAGTTAGAGTAATGAAGG - Intergenic
929265853 2:39918591-39918613 ATCAATAGCTAGACCAACCAAGG - Intergenic
930527782 2:52552135-52552157 AGCTTCAGCCAGACAAACTAAGG + Intergenic
931504386 2:62908348-62908370 ATCTTGAGCCAGACTGATTAGGG - Intronic
932661721 2:73660174-73660196 ATCTTTAGCTAGATTCACCAAGG - Intergenic
932743497 2:74311196-74311218 ATCTTTAGCCAGGCTAACCAAGG - Intronic
933005697 2:76991389-76991411 ACCACTAGCTAGACTAACAAAGG + Intronic
933855233 2:86406997-86407019 AACTTTAGCTAGATTAATCAAGG + Intergenic
934871101 2:97866431-97866453 ACCTTTAGCTATACTGACCAGGG - Intronic
934890499 2:98064426-98064448 ATCTTTAGCTAGACTGACCAAGG - Intergenic
935500056 2:103828109-103828131 ATCACTAGCTAGATTAACAAGGG - Intergenic
935551371 2:104460972-104460994 ATCTTTAGCTAGTCTCTTTAAGG - Intergenic
936914047 2:117621836-117621858 ATCTTTAGGCAGATTAACTTTGG - Intergenic
937109879 2:119356742-119356764 ATCTTGAGCAAGACCAGCTAGGG + Intronic
938211988 2:129475280-129475302 ATCTTTACCTACATTGACTAAGG + Intergenic
938683731 2:133716984-133717006 TTCTTTAGCTAGTCTCATTATGG + Intergenic
939087063 2:137733439-137733461 ATCTTTAGTTAGACTAACCAAGG - Intergenic
939189883 2:138903559-138903581 ATATCTAGCTAGACGAACCAGGG - Intergenic
939330624 2:140754912-140754934 ATCTGTAGCTAGACTAACAAAGG + Intronic
939336076 2:140829862-140829884 ACCTTTAGCTAGACTAATTAAGG + Intronic
940404014 2:153280260-153280282 ATCACTAGCTAGATTAACAAAGG - Intergenic
940684585 2:156830436-156830458 ATCACTTGCTAGACTAACCAAGG + Intergenic
941496844 2:166215511-166215533 ACCTTTAACTAGACTAACCAAGG + Intronic
941679491 2:168381580-168381602 ATCTTTAGCTGGAATAATTAAGG + Intergenic
941832223 2:169974557-169974579 ACCATTAGCTATACTAACCAAGG - Intronic
943272224 2:185821055-185821077 GTCTTTAGCTAGATTGCCTAAGG + Intronic
943468447 2:188261045-188261067 ATCATTAGCTAGACTAAGAAAGG + Intergenic
943709308 2:191072676-191072698 ATCTCTAGATAGACTGATTATGG + Intronic
944284545 2:197933551-197933573 ATCTTTAGCTATATTAGTTAAGG + Intronic
945145495 2:206733840-206733862 ATCTTGAGCAAGACACACTAGGG + Intergenic
946513133 2:220382043-220382065 ACCTTTAGCCAGACTAACTAGGG - Intergenic
946996296 2:225395838-225395860 ATTTTTAGTTAGAAAAACTATGG + Intergenic
947021229 2:225678311-225678333 ATCATTAGCTAGATGAACAAAGG - Intergenic
947465676 2:230342783-230342805 ATCTTTAGCTAGACTAACCAAGG - Intronic
1169617642 20:7467671-7467693 ACCTTTAGTCAGACTAACTAAGG - Intergenic
1170086697 20:12541554-12541576 AGCTTTAGCTAGACTAAAAGAGG - Intergenic
1171445527 20:25200685-25200707 ACCTTTAGCTAGACTGACTAAGG - Intronic
1173294514 20:41744403-41744425 ACCACTAGCTAGACTAACAAAGG - Intergenic
1177128309 21:17224510-17224532 ACCTTTAGCCAGACTTATTAAGG + Intergenic
1177514835 21:22135692-22135714 AGCTTTAGCTACACTTATTAGGG + Intergenic
951167220 3:19497146-19497168 ACCATTAGCTAGACTAACAAAGG - Intronic
953020697 3:39111225-39111247 ATCTTTAGATAGATTTTCTATGG + Intronic
953109932 3:39925193-39925215 ATCTTCAGCAAGACTCACAAGGG + Intronic
957772332 3:84710328-84710350 ACCATTAGCAAGACTAACCAAGG - Intergenic
958617828 3:96518336-96518358 AACATTAGCCAGACTAATTAAGG + Intergenic
959124652 3:102276041-102276063 ATCTTTATCCAGACTAACTGAGG - Intronic
959797844 3:110453618-110453640 ACCTTTAGCCAGATTAACTAAGG - Intergenic
960207530 3:114920833-114920855 ATCTTTAGCTAGATTACCCAAGG + Intronic
960633713 3:119761117-119761139 ACCTTTAACTAGACTACTTAAGG + Intronic
960823264 3:121757030-121757052 ATCTTTGGCTAGAGTAAATATGG - Intergenic
961392372 3:126560375-126560397 AGCTTTAGCTAGATTGACTAAGG - Intergenic
962758878 3:138490078-138490100 ACCTTTAGTCAGACTAACAAAGG - Intergenic
965289247 3:166856756-166856778 ATCTTTAGTAAGACTAATCAAGG + Intergenic
967351524 3:188519031-188519053 ATCTTTGCCTGAACTAACTATGG - Intronic
967960421 3:194917118-194917140 ATTTCTAGCTAGACTGACCAAGG - Intergenic
969996732 4:11320318-11320340 ATCCTTAGCAAAGCTAACTAAGG + Intergenic
971226392 4:24756334-24756356 ATTGTTAACTAGACTGACTAGGG - Intergenic
971432999 4:26588338-26588360 ATCTCTAGCCAGATTAATTAGGG - Intronic
971617837 4:28815769-28815791 ACCTTTAGCTGGACAAACTAAGG + Intergenic
974082491 4:57227203-57227225 ATCACTAGCTAGATTAACCAAGG - Intergenic
976551278 4:86398186-86398208 ATCTTTAGAAATACTAATTATGG - Intronic
976641660 4:87345554-87345576 ACCTTTAGCTACACTGACCAAGG + Intronic
977396759 4:96480194-96480216 ACCTTTAGCCAGACTAAGTGAGG - Intergenic
979111684 4:116765393-116765415 ACCTTCAGCCAGACTAACAAAGG + Intergenic
979169532 4:117583395-117583417 ATCTTTTGCTAGACTGCCTGTGG - Intergenic
980305719 4:131059287-131059309 TTCTTTAGTTAAACTAACTCAGG - Intergenic
980477832 4:133342288-133342310 ATAATTAGCTAGATTATCTAAGG - Intergenic
980539978 4:134180624-134180646 ACCTCTAGCTAGACTAATAAAGG + Intergenic
982611913 4:157585331-157585353 ACCTTTAGCTAGACTAAAGGGGG - Intergenic
983876789 4:172886430-172886452 CTCTTTAGCCAGACTAAGAATGG - Intronic
985934463 5:3084938-3084960 ATCTTTAGCTGGATTGGCTAAGG + Intergenic
987104142 5:14620484-14620506 TTCCTGAGCTAGAGTAACTATGG - Intergenic
987832168 5:23108722-23108744 ACCTCTAGCTATACTAACCAAGG + Intergenic
988507346 5:31834967-31834989 ATCTTTAGTTGGTCTAAATAAGG + Intronic
988642267 5:33053460-33053482 ACCTTTAGCTAGTCTAACTAAGG + Intergenic
989251600 5:39322584-39322606 ACCTTTAGCTAGGCTAACTCAGG + Intronic
989472344 5:41835068-41835090 ACCTTTAGCCAGACTAACAACGG + Intronic
989567413 5:42915330-42915352 CTCTTTTCCTAGACTAGCTATGG + Intergenic
990110800 5:52321171-52321193 CTCTTGAGCTAGACTAAAAAAGG - Intergenic
991663957 5:68978341-68978363 ACCTTTAGCCATACTAACAAAGG + Intergenic
992306347 5:75443110-75443132 ACCTTTAGCTAGATGGACTAAGG - Intronic
993341847 5:86734001-86734023 ACCACTAGCTAGACTAACCAAGG - Intergenic
994177177 5:96723668-96723690 AGCTTGAGCTAGAGTAACTTAGG - Intronic
994239262 5:97401295-97401317 ACCTTTAGCCAGAGTAACTTGGG - Intergenic
994308019 5:98230430-98230452 ACCCTTAGCTAGACTAACTAAGG + Intergenic
994596603 5:101845741-101845763 ATCTCTAGCCAGACTGACTGGGG + Intergenic
996188760 5:120512988-120513010 ACCTTTTTCTAGACTAAATATGG + Intronic
996584916 5:125075887-125075909 ATATTTGGCTAGATTAATTAAGG + Intergenic
996809302 5:127497002-127497024 AGCTCTAGCCAGGCTAACTAAGG + Intergenic
996993792 5:129669509-129669531 AAGTCTAGCTAGACTGACTAAGG - Intronic
999589321 5:153127109-153127131 AGCTTTAGCTAGGCTTAATAGGG + Intergenic
1000583940 5:163071455-163071477 ACCTTTAACCAGACTAACTCAGG - Intergenic
1000773554 5:165388367-165388389 AACTTTAGGTAGAATATCTAAGG + Intergenic
1002525411 5:179812883-179812905 CTCTTTTCCTAGACTAGCTATGG - Intronic
1003562413 6:7192687-7192709 ATGTTTAGCTAGATTGACTAAGG - Intronic
1003819528 6:9880695-9880717 ACCCTTAGCTAGACTAACTAGGG + Intronic
1005445798 6:25921351-25921373 ATCTTTAGCTCCATCAACTATGG - Exonic
1005624630 6:27651884-27651906 ACTTTTAGCTAGACTGACTAAGG + Intergenic
1009301870 6:62033880-62033902 ACCTTTAGCCAGAATAATTAAGG + Intronic
1011914350 6:92484728-92484750 ATCCTTAGCCACACTAACGAGGG - Intergenic
1012837606 6:104289815-104289837 ATCTTTAGCTAGACATCCAAAGG + Intergenic
1015849435 6:137556712-137556734 ACCATTAGCAAGACTAACCAAGG - Intergenic
1016458654 6:144258690-144258712 ACCCTTACCTAGATTAACTAAGG - Intergenic
1019945232 7:4323452-4323474 AACTTTAGCTAGACTGAACATGG - Intergenic
1021883317 7:25114413-25114435 ATCTTAACCTAGTCTAACTCAGG + Intergenic
1022348545 7:29543040-29543062 ACCTTTAGCCAGACTAATTAAGG + Intergenic
1023465187 7:40446899-40446921 ATATTTAGCTAGTGTGACTATGG + Intronic
1024320198 7:48058590-48058612 ATATTTAGCTAGACTAAGAGAGG - Intronic
1024434230 7:49330377-49330399 ATCCTTAGCTACAGTAGCTAAGG - Intergenic
1024917515 7:54518482-54518504 ACCTTTAGCTAGAATAACTAAGG - Intergenic
1028878569 7:95852397-95852419 ACTTTTAGCTGGGCTAACTAAGG - Intronic
1029235611 7:99115234-99115256 ATCTTTAGATAGACTGACCAAGG + Intronic
1030229648 7:107194092-107194114 ATCTTTTGCTATACTACCTTAGG - Intronic
1030695237 7:112577912-112577934 ATCTGTAGCTGGAAAAACTATGG + Intergenic
1030774210 7:113513589-113513611 ACCTTTAGCTAGACAACTTAGGG - Intergenic
1033947467 7:146739027-146739049 ATCTTTAGTTAGCCTAAGAAAGG - Intronic
1035765275 8:2100345-2100367 ATCTTCAGCTAGTCTCACTGTGG - Intronic
1036666727 8:10749225-10749247 ATCTTTAGGTAGATTGACTAAGG - Intronic
1037263082 8:17028872-17028894 ATCTGTTCCTAGACCAACTATGG - Intronic
1038877257 8:31565363-31565385 AACTTTAGCTAGATTGACTAAGG + Intergenic
1038892200 8:31738235-31738257 GTCTTTTGCAAGAGTAACTAAGG + Intronic
1039185005 8:34907030-34907052 AACTTTAGTTAGTATAACTATGG + Intergenic
1039271773 8:35889760-35889782 ATTTTTAAATAGACTTACTAGGG + Intergenic
1041443234 8:57921298-57921320 ATCTTTAGCCAGATTGACAAAGG + Intergenic
1042400489 8:68340435-68340457 AGCTTTAGCAAGACTGACAAAGG + Intronic
1042787623 8:72566986-72567008 ATCTTAAGCTAAACTGACCAAGG - Intronic
1043529274 8:81131829-81131851 ATTTATAGATAAACTAACTATGG - Intergenic
1043700373 8:83280092-83280114 AGCTTCAGCTAGATTAAGTAAGG - Intergenic
1044805037 8:95997827-95997849 ACCTCTAGCCAGTCTAACTAAGG + Intergenic
1044905879 8:97002161-97002183 ATTGCTAGCTAGACTAACAAAGG - Intronic
1045792892 8:106006534-106006556 TTCTTTAGCTAGACAAATTATGG + Intergenic
1046578969 8:116068105-116068127 ATCTTAAGCTATACTAAATCTGG + Intergenic
1046877411 8:119271097-119271119 ATGTTTATCTACACTAAATAGGG + Intergenic
1046919436 8:119712632-119712654 ACCTTTAGCTAGATTGACCAAGG - Intergenic
1047083263 8:121488291-121488313 ACCTTTAGCCAGACTACCTAAGG + Intergenic
1048776899 8:137956713-137956735 GTGATTAGCTAGATTAACTATGG - Intergenic
1050059830 9:1695503-1695525 ACCTTTACCTGGATTAACTAAGG + Intergenic
1050396784 9:5206706-5206728 ACCTTTAACTAGACAAACTAAGG + Intergenic
1052385089 9:27813301-27813323 ACCACTAGCTAGACTAACCAAGG - Intergenic
1052453098 9:28657647-28657669 ACCGTTAGCTAAACAAACTAAGG - Intronic
1052702514 9:31954434-31954456 ACCTTTAGCTAGACTGAAAAAGG + Intergenic
1055011147 9:71566815-71566837 ATCTTAAGCTAGCAGAACTATGG - Intergenic
1055186896 9:73467873-73467895 ATCATTAGCAAGATTAACCAAGG - Intergenic
1056094634 9:83240348-83240370 GCCTTTAGCTAGATTAACCAAGG - Intergenic
1056499498 9:87194306-87194328 ATCTTTAGCTAGAAAAGCAAAGG - Intergenic
1057689630 9:97271867-97271889 ACTGTTAGCTAGACTAACCAAGG - Intergenic
1059622133 9:116018395-116018417 ACCCTTAGCTAGACTAAGTAAGG - Intergenic
1061638591 9:131932360-131932382 ACCTTTAGCCAGACTAATTAGGG + Intronic
1186694445 X:12015141-12015163 ATCTTTATGTAGACTAACTTTGG + Intergenic
1188064128 X:25636721-25636743 ACCACTAGCTAGACTAACGAAGG + Intergenic
1188118581 X:26276918-26276940 ATCTTTAGCCAGACTAATGAAGG - Intergenic
1190371301 X:49744076-49744098 ACCATTAGCTAGACTAACAAAGG + Intergenic
1190423245 X:50307448-50307470 ATCTTTAGATAGTCTAGCTATGG - Intronic
1190901630 X:54680146-54680168 ACCACTAGCTAGACTAACAAAGG + Intergenic
1190993191 X:55574559-55574581 ACCTTAAGCTAGACTGATTAAGG + Intergenic
1192257595 X:69476854-69476876 ACCTCTAGCTAGACTGACTGAGG + Intergenic
1192332905 X:70192787-70192809 ACCCTTAGCTAAACTAACCAAGG + Intronic
1192540245 X:71962986-71963008 ATCTCTAGCTAGACTGACCAAGG - Intergenic
1192633737 X:72798002-72798024 ATCTTTAGCTAGACTAACTAAGG - Intronic
1192647973 X:72922799-72922821 ATCTTTAGCTAGACTAACTAAGG + Intronic
1192762609 X:74109494-74109516 ACCATTAGCTAGACTAACAAAGG + Intergenic
1192881411 X:75287920-75287942 ACCATTAGCTAGATTAACAAAGG + Intronic
1194083311 X:89495292-89495314 ACTTATAGCCAGACTAACTAAGG - Intergenic
1194248329 X:91541876-91541898 ATCACTAGCTAGACTAATAAAGG + Intergenic
1194352425 X:92837092-92837114 ATCTCTAGCCATACTAACTAAGG + Intergenic
1194504593 X:94716636-94716658 AACTTTATCTAGACTAAGAAAGG + Intergenic
1194921710 X:99774803-99774825 AACTTTACCCAGAATAACTAAGG - Intergenic
1194942116 X:100023540-100023562 ACCTTTACCCAGACTAACAAAGG + Intergenic
1194989619 X:100532792-100532814 ACATTTAGCTAGACTAAGTAAGG - Intergenic
1195563968 X:106321062-106321084 ATCTTTAGCTAGATTGACCAAGG + Intergenic
1196199789 X:112872781-112872803 ATCTCTTGCTTGAATAACTAGGG - Intergenic
1196360214 X:114845612-114845634 ATCTTTAGATAGACAGACTAAGG + Intronic
1197365498 X:125561233-125561255 ACCTTTAGCCAGACTAATGAAGG + Intergenic
1197400267 X:125980900-125980922 TTCTTTAGCCATGCTAACTAAGG + Intergenic
1198096067 X:133380916-133380938 ATCTGGAGCTTGTCTAACTAGGG - Intronic
1198665248 X:139014354-139014376 ACCTTTAGCCAGATTAACCAAGG + Intronic
1199143927 X:144343102-144343124 ACCTTTAGCCAGACTAACTAAGG - Intergenic
1199304268 X:146249015-146249037 ACCTTTAGCCAGACTAAGAAAGG + Intergenic
1199368040 X:147010836-147010858 ATCTTTAGCCAGACAAACTAAGG - Intergenic
1199707387 X:150440737-150440759 ATCTCTAGCAAGACTGACAAAGG - Intronic
1200567341 Y:4783396-4783418 ATCACTAGCTAGACTAATAAAGG + Intergenic
1201458205 Y:14194144-14194166 ATCTTTTCCTAAACTACCTATGG + Intergenic