ID: 1192664652

View in Genome Browser
Species Human (GRCh38)
Location X:73076812-73076834
Sequence CAGTATTTTCTCAGGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192664652_1192664656 25 Left 1192664652 X:73076812-73076834 CCTGTGTCCCTGAGAAAATACTG No data
Right 1192664656 X:73076860-73076882 GCAAGTGCAGAAAATCGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192664652 Original CRISPR CAGTATTTTCTCAGGGACAC AGG (reversed) Intergenic
No off target data available for this crispr