ID: 1192665007

View in Genome Browser
Species Human (GRCh38)
Location X:73079542-73079564
Sequence CGCCGCCGCAGCGGAGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 2, 1: 0, 2: 4, 3: 23, 4: 406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192665007_1192665019 26 Left 1192665007 X:73079542-73079564 CCGCAGCCTCCGCTGCGGCGGCG 0: 2
1: 0
2: 4
3: 23
4: 406
Right 1192665019 X:73079591-73079613 CGCCACCACCGTTGCCACCCGGG 0: 2
1: 0
2: 1
3: 11
4: 278
1192665007_1192665021 29 Left 1192665007 X:73079542-73079564 CCGCAGCCTCCGCTGCGGCGGCG 0: 2
1: 0
2: 4
3: 23
4: 406
Right 1192665021 X:73079594-73079616 CACCACCGTTGCCACCCGGGCGG 0: 2
1: 0
2: 0
3: 7
4: 53
1192665007_1192665018 25 Left 1192665007 X:73079542-73079564 CCGCAGCCTCCGCTGCGGCGGCG 0: 2
1: 0
2: 4
3: 23
4: 406
Right 1192665018 X:73079590-73079612 CCGCCACCACCGTTGCCACCCGG 0: 2
1: 0
2: 1
3: 48
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192665007 Original CRISPR CGCCGCCGCAGCGGAGGCTG CGG (reversed) Intergenic
900203168 1:1420282-1420304 ACCCGCGGCAGCGGAGGCGGAGG - Exonic
900349611 1:2228333-2228355 CGCCGCGGCGGCCGAGGCCGAGG - Intergenic
900366928 1:2315213-2315235 CGCCGCCTCCGCGGGGCCTGGGG - Intergenic
900882387 1:5391419-5391441 TGCCTCCTCAACGGAGGCTGAGG - Intergenic
901002280 1:6154768-6154790 CGCGGCAGCAGCGGCGGCGGCGG - Exonic
901060920 1:6471575-6471597 CGCAGCTGCACCGCAGGCTGTGG - Exonic
901540116 1:9910178-9910200 CGCCGCCGCAGCGGCTGCTCGGG - Exonic
901629009 1:10639208-10639230 CGCCGCCGCCGCCGCAGCTGGGG - Exonic
902044276 1:13513558-13513580 CGCCGCGGCGGCGCAGGCTGGGG + Exonic
903020390 1:20389678-20389700 CGCCGAAGCAGTGGAGGCCGCGG + Intergenic
903750418 1:25617498-25617520 CTCGGCCGGAGGGGAGGCTGCGG + Exonic
904641984 1:31938050-31938072 CGCCGCCGCCGAGGTGACTGAGG - Exonic
904642024 1:31938225-31938247 AGCGGCGGCAGCGGAGGCAGCGG - Exonic
905145286 1:35883257-35883279 GGCGGCGGCAACGGAGGCTGCGG + Exonic
905175660 1:36134013-36134035 GGCCGCTGCAGCAGAGGTTGGGG - Intergenic
905449286 1:38046644-38046666 CGCCGCGGCGGCGGCGGCGGCGG - Exonic
906069597 1:43007451-43007473 CGGCTCCGCTGGGGAGGCTGCGG + Intergenic
906146859 1:43565629-43565651 CGCCCCCGGCGCTGAGGCTGAGG + Intronic
906190946 1:43899162-43899184 AGCGGCGGCAGCGGAGGCTGAGG - Exonic
906264451 1:44417837-44417859 CGCCTCGGTGGCGGAGGCTGGGG - Intronic
906480951 1:46198471-46198493 CCCCGCGGCAGCGGCGGCGGCGG - Intronic
907268510 1:53276929-53276951 CGCCGCCGCAGCGGAACTCGCGG + Exonic
908132056 1:61083356-61083378 GGCTGCGGCAGCGCAGGCTGCGG - Intronic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
908951583 1:69568286-69568308 CGCAGCAGCAGCGGCGGCGGCGG - Intergenic
908951584 1:69568287-69568309 CGCCGCCGCCGCTGCTGCTGCGG + Intergenic
912174721 1:107141344-107141366 GGCCGCAGCAGCGGAGCCCGCGG - Intronic
914872284 1:151485102-151485124 CCCAGCCACAGGGGAGGCTGAGG - Intergenic
915167861 1:153958538-153958560 CGAGGCCGCGGCGGAGGCCGCGG - Exonic
916065508 1:161132647-161132669 CGCCGCCGCCGCCGCGGCCGTGG + Exonic
918800811 1:188969228-188969250 CCCCGCTGCTCCGGAGGCTGAGG - Intergenic
920396434 1:205649383-205649405 CCCAGCCGCTGGGGAGGCTGAGG - Intergenic
920933682 1:210411637-210411659 CCCAGCTGCAGGGGAGGCTGAGG + Intronic
921039472 1:211416462-211416484 CGCCGGCGCTCCGGAGGCAGGGG - Intergenic
921155068 1:212432954-212432976 CCGCGCCGCGGCGGCGGCTGCGG + Exonic
922562395 1:226578731-226578753 AGCCGCTGCAGGGGTGGCTGTGG - Intronic
924362359 1:243254978-243255000 AGCAGCCGCGGCGGTGGCTGCGG + Intronic
924775340 1:247111876-247111898 AGCTGGCGCAGCGGAGGGTGCGG + Exonic
1062774755 10:135644-135666 CGCCGCCGCCCCAGAGGCCGCGG - Intronic
1063452995 10:6163846-6163868 AGTCGCCGCAGAGCAGGCTGGGG - Intronic
1064086506 10:12349650-12349672 CGCCGCCGCCGCCGCGGCCGCGG - Exonic
1064619609 10:17201711-17201733 CGCCGCGGAACCAGAGGCTGAGG - Intronic
1064665244 10:17644163-17644185 CGCCGCCGCAGCTGCTGCCGCGG + Exonic
1065845083 10:29736859-29736881 CGCCGCCGGAGCAGAGCCAGTGG + Intergenic
1067204082 10:44198863-44198885 AGCTGCCGCTGGGGAGGCTGAGG + Intergenic
1067484540 10:46635495-46635517 CGCCGCCGCCGCGGTTGATGTGG - Intergenic
1067560324 10:47300580-47300602 CGCTGGCGCACCGGAGGCTGCGG - Exonic
1067610219 10:47706152-47706174 CGCCGCCGCCGCGGTTGATGTGG + Intergenic
1068989145 10:63133372-63133394 CGACGCAGCCGCGGAGACTGCGG - Exonic
1069792821 10:71034130-71034152 CTCAGCCGCAGCTGAGCCTGAGG - Intergenic
1071784093 10:88880168-88880190 CGCCGCCACAGAGGAGGGGGCGG + Exonic
1072915526 10:99535459-99535481 CGCCGCTGCTGCGGCGGCGGCGG - Exonic
1072961545 10:99933850-99933872 CCCAGCTGCTGCGGAGGCTGAGG - Intronic
1075519700 10:123136244-123136266 CGCCGCGGCAGCGGCAGCGGCGG - Exonic
1075802109 10:125160258-125160280 CGCGGCCGCAGGTGAGGCGGGGG + Intronic
1075816475 10:125268556-125268578 CCCAGCCGCTGGGGAGGCTGAGG - Intergenic
1077213335 11:1383429-1383451 TTCCGCAGCAGCGGAGGCCGCGG + Intergenic
1077503436 11:2919481-2919503 CTCCTCCCCGGCGGAGGCTGGGG + Intronic
1078606086 11:12776908-12776930 CCCAGCCACTGCGGAGGCTGAGG - Intronic
1079195661 11:18324164-18324186 CCCAGCCGCTGGGGAGGCTGAGG - Intronic
1083945067 11:65919097-65919119 CGCGGCCGCTGCGGCCGCTGAGG - Exonic
1084000176 11:66291853-66291875 CGCGGCGGCAGCGGCGGCGGCGG - Exonic
1084331632 11:68433774-68433796 CGCCGTCGCAGCGCAGGCGCAGG - Exonic
1084517978 11:69646673-69646695 CCCCACCCCAGCGGAGCCTGGGG - Intronic
1085561273 11:77474212-77474234 CGGCGCGGCGGCGGCGGCTGCGG + Intronic
1087672822 11:101127788-101127810 CGCGGCGGCAGCGGGGGCGGTGG + Exonic
1088256498 11:107908395-107908417 CGCCGCCGCCGCAGACGCCGCGG + Intronic
1088325114 11:108593287-108593309 AGCGGCTGCTGCGGAGGCTGCGG - Intronic
1088380279 11:109185156-109185178 CCCCGCTGCTGGGGAGGCTGAGG - Intergenic
1088462057 11:110092896-110092918 CGGCGCGGCTGCGGTGGCTGCGG + Intergenic
1090391050 11:126387559-126387581 CGCAGCCACTGGGGAGGCTGAGG + Intronic
1090403766 11:126465395-126465417 CGGGGCTGCAGCAGAGGCTGTGG - Intronic
1091823169 12:3491301-3491323 CGCCGCCGCCGCGGAGGCTTCGG + Exonic
1092261022 12:6953404-6953426 GGCCCCTGCAGAGGAGGCTGAGG + Intronic
1094719941 12:33052925-33052947 CGCCGCCGCCGGGCAGGCCGGGG + Intergenic
1096100916 12:48970046-48970068 CGGCGCTGCCGCGGAGGCTAGGG - Intronic
1096264416 12:50111791-50111813 CGTCACCGCACCGTAGGCTGAGG + Intergenic
1096533828 12:52258402-52258424 CGCGGCCTCACCGGAGGCTTCGG - Intronic
1097043314 12:56169528-56169550 CGCCGCCGCAGTGAAAGCTAAGG - Exonic
1097686359 12:62694596-62694618 CGCCTCCGCTGTGCAGGCTGTGG - Intronic
1100309234 12:93378492-93378514 CCCCGCCCCTGCGCAGGCTGCGG + Intronic
1101253832 12:102958363-102958385 CGCTGCCGCTGCGGCGGCTGCGG - Exonic
1101674822 12:106908143-106908165 GGCCACCTCAGCTGAGGCTGGGG - Intergenic
1102256425 12:111418189-111418211 GGCCGCCGCCGGGGAGGCTGAGG - Exonic
1103383490 12:120513384-120513406 CCCAGCTGCTGCGGAGGCTGAGG + Intronic
1103433023 12:120904098-120904120 CGCCGCCGCCGCCGCGGGTGAGG - Exonic
1103563598 12:121804676-121804698 CTCCGCCGCGGCGGCGGCGGCGG - Intronic
1103968631 12:124655769-124655791 CGCCTCCCCAGCTGAGGCCGGGG + Intergenic
1104376220 12:128267223-128267245 CGCCGCCGCAGCTCCGGCTCTGG - Intergenic
1104444711 12:128823859-128823881 GGCGGCCGCGGCGGCGGCTGGGG - Exonic
1104841453 12:131828032-131828054 CGCCGCCGCAGCGCAGCAGGTGG - Intergenic
1105071360 12:133235967-133235989 CGCGGTCGCATCGGGGGCTGAGG - Exonic
1105307889 13:19181789-19181811 CGCAGCTGCAGCGGCGGTTGAGG - Exonic
1105479939 13:20765526-20765548 CGCAGCCACTGGGGAGGCTGAGG - Intronic
1106246384 13:27953888-27953910 AGCCGCCGCAGGAGGGGCTGAGG - Intergenic
1107604029 13:42040812-42040834 CCCCGGCGCAGCGGCGGCGGCGG + Intronic
1108227456 13:48303944-48303966 CGCGGCGGCAGCGGCGGCGGTGG - Exonic
1108662740 13:52601151-52601173 CCCAGCTGCTGCGGAGGCTGAGG - Intergenic
1110119753 13:71866513-71866535 GGCGGCGGCAGCGGAGGCGGCGG - Exonic
1112507197 13:99982133-99982155 CTCCGCCGCGGCGGCGGCGGCGG + Exonic
1112652763 13:101416515-101416537 CGCCGCCGCCGGGCAGGCTGGGG + Intergenic
1113254839 13:108495690-108495712 CGCCGCCGACGCCGCGGCTGCGG + Intergenic
1113789915 13:113022766-113022788 CCCCACCGCGGCGGCGGCTGAGG + Intronic
1114519009 14:23321490-23321512 GGCAGCAGCAGCGGGGGCTGCGG + Exonic
1116657969 14:47674982-47675004 CGCCGCCGCCGCCGCAGCTGCGG - Intergenic
1117769516 14:59118908-59118930 CACCTCTACAGCGGAGGCTGTGG + Intergenic
1117995983 14:61478742-61478764 CCCAGCCGCACAGGAGGCTGAGG + Intronic
1118981561 14:70721106-70721128 CCCAGCCGCTGGGGAGGCTGAGG + Intergenic
1119743212 14:77027300-77027322 CGCCGCCGCCGCCGCCGCTGCGG - Exonic
1120204680 14:81574861-81574883 CTCAGCCTCAGCGGAGGCTTGGG + Intergenic
1121417424 14:93788779-93788801 GGCCGCCGAGGCGGAGGCAGAGG + Intergenic
1122270761 14:100567676-100567698 GGCCGCTGCGGCGGGGGCTGGGG - Intronic
1122486760 14:102087140-102087162 CGCGGCCGCGGCGGCGGCTGGGG - Intronic
1122603028 14:102930570-102930592 AGCCGCCGCGGCAGGGGCTGCGG - Exonic
1122819093 14:104332318-104332340 CTCAGCAGCAGCAGAGGCTGAGG - Intergenic
1122827220 14:104376173-104376195 GGCCGCCGCAGAGAAGGATGCGG - Intergenic
1122971379 14:105153602-105153624 CGCCCCCCCACCGGATGCTGCGG - Intronic
1123806424 15:23878146-23878168 CGCAGCCTCACCGGAAGCTGTGG + Intergenic
1124102965 15:26712832-26712854 CGTGGCCGGAGCAGAGGCTGAGG + Intronic
1124160447 15:27263808-27263830 CCCCGCTGCTCCGGAGGCTGAGG + Intronic
1124328006 15:28783699-28783721 CCCAGCCGCTCCGGAGGCTGAGG - Intergenic
1124431740 15:29614282-29614304 CGCCGCCGCAGAAGAGGGAGAGG + Intergenic
1124646547 15:31441105-31441127 CACCGCCCCAGCGGAGCCAGCGG + Intergenic
1125492711 15:40160177-40160199 CGCAGCTACTGCGGAGGCTGAGG + Intergenic
1125626834 15:41115990-41116012 CGCCGCCGCGACGGCGGCGGAGG + Exonic
1127510886 15:59639864-59639886 CCCAGCTGCTGCGGAGGCTGAGG - Intronic
1128067852 15:64775589-64775611 CGCCGCGGCGGCGGCGGCGGCGG + Intergenic
1128841373 15:70853920-70853942 CGCTGCCCCAGCCGGGGCTGAGG + Exonic
1130564496 15:84981968-84981990 CGCTGCGGCGGCGGCGGCTGCGG - Exonic
1131094810 15:89648492-89648514 GGCGGCCGCCGCGGAGGCGGTGG + Exonic
1132474532 16:127349-127371 CCCAGCCACTGCGGAGGCTGAGG - Intronic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1132866281 16:2094159-2094181 CGCTGGCGCTGCAGAGGCTGGGG - Exonic
1132934823 16:2474992-2475014 GGCCGCAGCGGCGGAAGCTGGGG - Intergenic
1133021622 16:2969450-2969472 CCGCGCCGGGGCGGAGGCTGGGG - Exonic
1133268777 16:4600402-4600424 CCCCTCCACATCGGAGGCTGAGG + Exonic
1133315641 16:4882138-4882160 CGAGGCCGCAGCAGAGGGTGGGG + Exonic
1133726055 16:8538621-8538643 CGCAGCTGCTGGGGAGGCTGAGG - Intergenic
1134615746 16:15650190-15650212 CGCCCCCGCCCCGGAGCCTGCGG - Intronic
1135296535 16:21283931-21283953 CCCCGCAGCGGCGGAGGCGGCGG + Intronic
1136155473 16:28379329-28379351 CGCAGCCGCTTGGGAGGCTGAGG - Intergenic
1136207611 16:28735960-28735982 CGCAGCCGCTTGGGAGGCTGAGG + Intergenic
1136546533 16:30958018-30958040 CGGCCCCGCAGCGGTGGCGGCGG - Intronic
1138048954 16:53755682-53755704 CCCCGTTGCAGGGGAGGCTGGGG - Intronic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1140837009 16:78804092-78804114 CCCCGCCGCAGTGGAGATTGTGG + Intronic
1141704532 16:85657457-85657479 TGGCGCGGCAGCGGCGGCTGCGG + Exonic
1141858002 16:86697915-86697937 CGCCGGCGCTGCTGTGGCTGTGG + Intergenic
1142042145 16:87901112-87901134 CCCAGCCGCATGGGAGGCTGAGG + Intronic
1142552981 17:752287-752309 CGCGTGCGCGGCGGAGGCTGTGG - Intronic
1142817359 17:2436995-2437017 CCCAGCTGCTGCGGAGGCTGAGG - Intronic
1143155501 17:4833679-4833701 CCCCGCCGCAGGGGAGGGAGCGG + Intronic
1143590666 17:7884686-7884708 CGCCGCCGCCGAGGAGGAGGAGG + Intronic
1144592390 17:16535776-16535798 CGCCTGCGCAGCGGAGGCTGTGG + Intergenic
1144758579 17:17694655-17694677 CGCCACCGCGGAGGAGGCTCCGG - Intronic
1145385516 17:22409225-22409247 CGCCTGCGCAGCCGCGGCTGCGG - Intergenic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1146356911 17:32142351-32142373 GGCCGCCGCAGCGCAGGCCCAGG - Exonic
1147110219 17:38256664-38256686 CGTGGCCGGAGCTGAGGCTGGGG - Intergenic
1147748781 17:42713267-42713289 CTCAGCCACAGCAGAGGCTGAGG + Exonic
1148419287 17:47531755-47531777 CGTGGCCGGAGCTGAGGCTGGGG + Intronic
1148852197 17:50560811-50560833 CGCCGCCGCAGCCGCCGCGGTGG - Intergenic
1149809486 17:59654113-59654135 CCCAGCCACAGAGGAGGCTGAGG - Intronic
1150791921 17:68205840-68205862 CGCCGCCGCCGCCTAGGTTGAGG + Intergenic
1151314317 17:73312246-73312268 CGCGGCCGGAGCGCAGGCTGGGG - Intergenic
1151858221 17:76737760-76737782 AGACGACGCAGCGGAGTCTGAGG - Exonic
1152526828 17:80893106-80893128 CGCAGCCGCAGTTGAGGCGGTGG + Intronic
1152530998 17:80919029-80919051 CGCCGCGTCAGTGGAGGCCGAGG - Intronic
1152941745 17:83176442-83176464 AGCAGCAGCAGCGGAGGCTGGGG + Intergenic
1153354372 18:4119205-4119227 CCCAGCTGCAGGGGAGGCTGAGG - Intronic
1154078201 18:11225839-11225861 AGCCGCTGCAGCCGAGGCTTGGG - Intergenic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1156099597 18:33578269-33578291 CGCCACCGCCGCGGCCGCTGCGG - Intergenic
1156171758 18:34494057-34494079 CGCGGCAGCAGCAGGGGCTGCGG - Intronic
1157610480 18:48952100-48952122 CGGCGCGGCTGCGGCGGCTGGGG - Intergenic
1158190965 18:54828434-54828456 CGCCGCCGCGGCGGACTCCGAGG + Exonic
1159102349 18:63970625-63970647 CGCCGCTGCGGAGGAGGCTCCGG + Intronic
1159954530 18:74510037-74510059 CTCCACTGCAGCTGAGGCTGAGG - Intronic
1160024929 18:75209227-75209249 CGCCGGCGCCGGGGAGGCGGGGG - Exonic
1160548826 18:79680177-79680199 CGCGGCCGGAACGCAGGCTGAGG + Exonic
1160960609 19:1719051-1719073 CGCCGCCGCAGCGGGGCTGGGGG + Intergenic
1161087863 19:2343459-2343481 GGCCGCCTCAGCGGGGGCTTTGG - Intronic
1161089147 19:2351676-2351698 CGCGGCCGCAGGGCTGGCTGTGG - Intronic
1161264827 19:3359431-3359453 AGCCGCCGCAGCCGGGGCCGCGG + Intergenic
1161522885 19:4735434-4735456 CCCCGCTGCTCCGGAGGCTGAGG + Intergenic
1161692545 19:5745184-5745206 GGCCGCGGCGGCGGAGGGTGGGG - Intronic
1161932075 19:7347644-7347666 CCCAGCCGCTCCGGAGGCTGAGG - Intergenic
1162698387 19:12495369-12495391 CGCCGCCGGAGCGGTGGGTGGGG + Intronic
1162778643 19:12995567-12995589 CGCGGCGGCAGCGGCGGCGGCGG + Intergenic
1162802332 19:13118399-13118421 GGGCTCCGCAGCGGCGGCTGGGG - Exonic
1162861099 19:13506289-13506311 CGCCGCCGCCGCTGATGCTGAGG + Intronic
1163115006 19:15183934-15183956 CGCAGCCACTGGGGAGGCTGAGG + Intronic
1163513082 19:17747720-17747742 CGCCGCAGCCGCGGAGGGAGGGG + Exonic
1163664159 19:18595226-18595248 TGCGTCCGCAGGGGAGGCTGGGG - Intronic
1163804150 19:19386013-19386035 CGCCGCCACAGCGGCCGCCGCGG + Exonic
1164977086 19:32581395-32581417 CGCCTCCGGGGCGGAGGCTCTGG + Intronic
1165157127 19:33795731-33795753 GGCGGCCGAAGCGGAGACTGGGG + Intergenic
1167679798 19:50912321-50912343 CGCCGCAGCAGGGGCGGTTGCGG + Intergenic
1167743658 19:51339071-51339093 AGCAGCGGAAGCGGAGGCTGCGG + Exonic
1167843417 19:52140106-52140128 CGGAGCCGCGGCGGAGGATGGGG + Intergenic
1168102481 19:54148451-54148473 GGCGGCGGCAGCGGAGGCGGAGG + Exonic
1168719056 19:58544882-58544904 CGACGCCGCGGCTGAGGCAGAGG - Exonic
926217100 2:10912357-10912379 CGCCGCCGCCGCTGCCGCTGGGG - Exonic
926784740 2:16508337-16508359 CCCCGCCGCTGCGGCGTCTGCGG + Intergenic
927652293 2:24920042-24920064 CGCCGCCGCCGCGGGTGCAGGGG - Intergenic
933375705 2:81477529-81477551 CCCAGCTGCAGGGGAGGCTGAGG - Intergenic
934248183 2:90324691-90324713 CGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934248357 2:90325304-90325326 CGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934248368 2:90325342-90325364 CGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934248379 2:90325380-90325402 CGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934248395 2:90325444-90325466 CGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934467090 2:94273025-94273047 AGCCGCGGCAGCGGGGGCGGGGG + Intergenic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
934958768 2:98648601-98648623 CCCAGCCGCACAGGAGGCTGAGG + Intronic
935196643 2:100820239-100820261 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
935196644 2:100820240-100820262 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
935255667 2:101308072-101308094 CTTCGCGGCAGCCGAGGCTGGGG - Intronic
935592506 2:104855446-104855468 CGCCGCCGCAGCAGCAGCCGCGG - Intergenic
935692617 2:105744883-105744905 CCCCGCGGCAGCGGCGGCGGCGG - Exonic
936122758 2:109760663-109760685 CGCCGCCGCCGCCGAAGCTCGGG - Intergenic
936221935 2:110610810-110610832 CGCCGCCGCCGCCGAAGCTCGGG + Intergenic
936594162 2:113831886-113831908 CCCAGCTGCAGGGGAGGCTGAGG - Intergenic
936790475 2:116144998-116145020 CCCAGCCACAGGGGAGGCTGAGG + Intergenic
937333872 2:121048604-121048626 CCCAGCCGCTGGGGAGGCTGAGG + Intergenic
940453766 2:153871994-153872016 CGCGGCCAGAGCGGACGCTGAGG - Exonic
941548426 2:166883622-166883644 CCCAGCTACAGCGGAGGCTGAGG + Intergenic
942448395 2:176093064-176093086 GGCGGCGGCAGCGGCGGCTGCGG + Exonic
944660004 2:201913745-201913767 CTCCCCTGCAGCTGAGGCTGGGG + Intergenic
945306765 2:208266356-208266378 AGCCGTTGAAGCGGAGGCTGGGG + Exonic
945431726 2:209772239-209772261 CGCGGCCTCAGCGGCGGCGGCGG - Intronic
945988175 2:216371471-216371493 CGCCGCCGCAGCAGCAGCTGCGG - Exonic
946692486 2:222319760-222319782 CGCGGCGGCAGCGGCGGCGGCGG + Intergenic
947200274 2:227608814-227608836 GGCCGCTGCAGTGGTGGCTGTGG + Intergenic
947625208 2:231614487-231614509 AGCCGGGGCAGGGGAGGCTGGGG - Intergenic
947741724 2:232487821-232487843 CGCGGCGGCAGAGGAGGCGGCGG - Exonic
948487252 2:238288757-238288779 CTCGGCCGCGGCGGAGGCGGCGG - Intronic
948625201 2:239264243-239264265 CTCCTCCGCAGTGGAGGCTGGGG - Intronic
948988931 2:241542012-241542034 CGCGGCCGCTGCGGAGGGTTTGG + Intergenic
1170175689 20:13466623-13466645 CCCAGCCACAGGGGAGGCTGAGG + Intronic
1170813238 20:19691630-19691652 CCTGGCCCCAGCGGAGGCTGTGG + Intronic
1172095064 20:32456545-32456567 GGCTGCCTCAGCTGAGGCTGTGG - Intronic
1172937314 20:38629494-38629516 CCCCGCAGCAGCAGAGCCTGGGG + Exonic
1173672872 20:44810292-44810314 CGCCGCCGCCGCCGCGGCCGAGG - Intronic
1174467709 20:50730773-50730795 CGCCTCTGCAGCGGTTGCTGGGG - Intergenic
1175785413 20:61708715-61708737 CGCCGCCTCATGTGAGGCTGGGG - Intronic
1176043906 20:63082677-63082699 CACCGACGCTGGGGAGGCTGGGG - Intergenic
1176105065 20:63382032-63382054 CGCAGCACCAGCGGGGGCTGGGG + Intergenic
1176414521 21:6467206-6467228 CTCCGCCGGCGCGGGGGCTGGGG + Intergenic
1176548598 21:8212235-8212257 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176556492 21:8256443-8256465 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176567529 21:8395270-8395292 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176575431 21:8439485-8439507 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176705832 21:10119602-10119624 CGCCGCGGCTGCGGGGACTGGGG + Intergenic
1178351003 21:31873247-31873269 CGGCGGCGAGGCGGAGGCTGCGG + Intergenic
1178513828 21:33229896-33229918 CGCCGCCGGCGCGGGGGCGGGGG - Intronic
1178673909 21:34614960-34614982 CGGGGCCGCGGCGGAGGCGGCGG - Exonic
1178865093 21:36320399-36320421 CGACGCGGCGGCGGGGGCTGCGG + Intronic
1179529706 21:42010312-42010334 CACAGCGGCAGCGGCGGCTGCGG - Exonic
1179690019 21:43075528-43075550 CTCCGCCGGCGCGGGGGCTGGGG + Intronic
1180177715 21:46098418-46098440 CTCCGCCCCAGAGGAGGCCGCGG - Intronic
1180716898 22:17877966-17877988 CTCCGCCACTGGGGAGGCTGAGG - Intronic
1180841277 22:18960010-18960032 CGGCTCCCCAGCTGAGGCTGAGG + Intergenic
1181454870 22:23053403-23053425 CACCCCTGCAGCAGAGGCTGAGG - Intergenic
1181690225 22:24555097-24555119 CTCCTCCGCAGCGGCGGCGGTGG - Intronic
1182475522 22:30574593-30574615 CGGCGCGGCAGCGGCGGCGGGGG - Intergenic
1183123089 22:35746496-35746518 GGCTGCAGCAGCGGTGGCTGCGG + Exonic
1184153153 22:42649817-42649839 CGCCGCCGGCGAGGAGGCTCCGG - Intergenic
1184557388 22:45240739-45240761 CGCCGCCGCCCCCGAGCCTGCGG - Intronic
1184794978 22:46726916-46726938 AGCAGCCGCAGCGGAGGCAAGGG - Intronic
1185055266 22:48575866-48575888 CGCCGCGGCGGCGGTGGCGGCGG + Intronic
1203261536 22_KI270733v1_random:173618-173640 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
950000033 3:9649600-9649622 CGCCGAGGCAGCGGCGGCGGCGG - Exonic
951078513 3:18425155-18425177 CGCCGCCGCCGCTGCCGCTGTGG + Intronic
951080304 3:18444729-18444751 CGCCGCCGCCGCCGGAGCTGCGG + Intronic
951907893 3:27721907-27721929 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
951907894 3:27721908-27721930 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
952908882 3:38165601-38165623 CGCTGCTGCTGCGGAGGCCGAGG + Exonic
953357503 3:42267005-42267027 CCCAGCCGCTGGGGAGGCTGAGG - Intergenic
953897363 3:46812502-46812524 CGGCGCCACGACGGAGGCTGAGG - Exonic
954186195 3:48918898-48918920 CGAAGCGGCAGCGGAGGCGGCGG - Exonic
954540713 3:51391568-51391590 CCCCGCGGCAGCGGAAGCGGCGG + Exonic
954739510 3:52737050-52737072 CCCAGCGGCAGGGGAGGCTGAGG - Intronic
954803202 3:53199320-53199342 AGCCGCCCCAGCCGAGGGTGGGG + Intergenic
954912784 3:54122679-54122701 CGCCGCCGCAGCGGGCGCGTCGG + Exonic
955228417 3:57079268-57079290 CACCGCGGCGGCGGCGGCTGCGG + Exonic
956468644 3:69542629-69542651 CGCCGCCTCTCCGGGGGCTGGGG + Intergenic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
963253095 3:143120073-143120095 CGACCCCGCAGCGGCGGCGGCGG - Exonic
963599901 3:147369846-147369868 CCGCGCCGCAGCTGAGCCTGTGG - Intergenic
964874230 3:161347755-161347777 CCCAGCCGCTGGGGAGGCTGAGG + Intronic
965231935 3:166065508-166065530 CTCCGCTGCTCCGGAGGCTGAGG - Intergenic
965590666 3:170357783-170357805 CGGCGACGCGGCGGAGGCGGCGG + Intronic
965881659 3:173395663-173395685 CGCGGGCGCTGCGGAAGCTGCGG + Intergenic
966187821 3:177244080-177244102 CGCAGCTGCTGTGGAGGCTGAGG - Intergenic
966362773 3:179148365-179148387 TGCCGCCGCTGCGGCCGCTGAGG + Intronic
966517126 3:180830183-180830205 TGCTGCAGCAGCAGAGGCTGAGG - Intronic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
968562194 4:1289988-1290010 CGCCTGCGCCGCGCAGGCTGAGG + Intronic
969972147 4:11058857-11058879 CACGGCAGCAGCAGAGGCTGAGG + Intergenic
972586823 4:40445156-40445178 CCCAGCCACAGGGGAGGCTGAGG + Intronic
972725831 4:41745992-41746014 GGCCGCGGCAGCGGCGGCGGCGG - Exonic
974683659 4:65195824-65195846 TGAGGCCGCAGAGGAGGCTGTGG + Intergenic
975616475 4:76252095-76252117 AGCCTCCGCAGCGGACTCTGCGG - Intronic
975633041 4:76421113-76421135 CGGCGCCGCAGCCGAGGAGGAGG - Intronic
975986252 4:80203223-80203245 TGCCGCTGCAGCCGCGGCTGCGG + Exonic
976830293 4:89307646-89307668 CCCCGCCACAGCGCAGGCAGTGG - Exonic
981576661 4:146213008-146213030 TGCCGGCTCAGCAGAGGCTGTGG + Intergenic
981641234 4:146945831-146945853 CTCCGCCGGAGCGGAGACAGGGG + Exonic
982712273 4:158769185-158769207 CGCCGCCGCAGCTCCGGCCGTGG - Exonic
984973366 4:185209753-185209775 CGCCGGCGCTCCGGAGGCAGGGG - Intronic
985722376 5:1496507-1496529 CGAGGCTGCAGAGGAGGCTGCGG + Intronic
986748173 5:10761662-10761684 CGCTGCCGCGGCAGGGGCTGAGG - Intergenic
988184072 5:27836930-27836952 CAGCGCCGCTGCGGAGTCTGAGG + Intergenic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
991683022 5:69157120-69157142 CCCCGCTGCTGGGGAGGCTGAGG + Intergenic
993116159 5:83722248-83722270 CGCCGCCGCCGCTCGGGCTGTGG + Intergenic
993386412 5:87268002-87268024 CGGTGCCGCTGCTGAGGCTGGGG - Exonic
994487952 5:100402674-100402696 CCCAGCTGCTGCGGAGGCTGAGG + Intergenic
995106243 5:108381030-108381052 CGCTGCGGCGGCGGGGGCTGCGG - Exonic
995224708 5:109689791-109689813 CGCCGCCGCCGCCGACGCTGCGG - Exonic
996518064 5:124395482-124395504 CCCTGCTGCCGCGGAGGCTGTGG - Intergenic
997142431 5:131397055-131397077 CACAGCAGCAGCGGAGGCTCTGG - Intronic
997302080 5:132813635-132813657 GGCAGCCGCAGCGGCGGCGGCGG - Exonic
997302084 5:132813639-132813661 CGCCGCCGCTGCGGCTGCCGGGG + Exonic
997965476 5:138352866-138352888 CGCCGCGGGAGCCGAGGCCGAGG - Exonic
997980606 5:138465565-138465587 CGCCGCGGCTGCGGAGGCTGGGG - Exonic
998095130 5:139392373-139392395 CGCCGCGGCAGCCTCGGCTGCGG - Exonic
998166674 5:139848287-139848309 CGCGGCCGCGGCGGCGGCGGGGG + Exonic
998203900 5:140145908-140145930 TTCCGCCGCGGCGGCGGCTGCGG + Intergenic
1002033464 5:176447827-176447849 CGCCTTCGAAGCGGAAGCTGTGG - Intronic
1002397975 5:178972660-178972682 GCCCGACGCAGCTGAGGCTGAGG + Intergenic
1003182747 6:3806226-3806248 CTCGGCTGCAGCGGTGGCTGTGG - Intergenic
1004251572 6:14026972-14026994 GGCAGCCGCAGCTGTGGCTGTGG + Intergenic
1004864278 6:19837867-19837889 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
1004864279 6:19837868-19837890 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
1004924115 6:20402593-20402615 CGCGGCGGCAGCGGCGGCGGCGG + Exonic
1004965735 6:20848906-20848928 CGCCACTACTGCGGAGGCTGAGG - Intronic
1005912996 6:30327009-30327031 CGCCGCCGCGCCCGAGCCTGGGG + Intronic
1006302352 6:33200321-33200343 CGCCGCCGCCGCCGCCGCTGCGG + Exonic
1007032371 6:38639909-38639931 CGCCGCCGCCCCGGCTGCTGCGG + Exonic
1007032372 6:38639911-38639933 CGCCGCAGCAGCCGGGGCGGCGG - Exonic
1007665292 6:43509935-43509957 TGCGGCTGCGGCGGAGGCTGCGG + Exonic
1007902044 6:45422026-45422048 GGCGGCCGCCGCGGAGGCGGCGG + Intronic
1008649063 6:53544939-53544961 CGCCGCCGCATCGGAGCGGGAGG - Exonic
1009437624 6:63636071-63636093 CGCCGCCGAAGAGGAGGAGGAGG - Exonic
1011044702 6:83068089-83068111 CGCCCCAGCAGGGGAGGCTCGGG - Intronic
1011652356 6:89518284-89518306 CCCAGCTGCTGCGGAGGCTGAGG + Intronic
1012475915 6:99614307-99614329 GGCGGCGGCAGCGGAGGCAGCGG + Exonic
1013507594 6:110815342-110815364 CGCCGCCGTCGCGGAGGAGGAGG - Intronic
1014569985 6:122996668-122996690 CGCCGCCGCTGCTGAAGCCGCGG + Exonic
1015251832 6:131135534-131135556 TGCCGCTGCCGCGGGGGCTGCGG + Intergenic
1016010790 6:139135624-139135646 TGCGGCCGCCGCGGGGGCTGCGG + Exonic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1017045976 6:150347612-150347634 CCCAGCCGCACGGGAGGCTGAGG - Intergenic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1018400483 6:163415129-163415151 CGCCGCCGGAGAGGAGGGAGGGG - Exonic
1018876562 6:167826987-167827009 CGGCGCGGCCGCGGAGGCGGAGG + Exonic
1020035016 7:4959308-4959330 CTCCACCTCAGCGGAGGCGGCGG - Intergenic
1020215538 7:6187247-6187269 TGCCGCCACTGCGGAGACTGGGG - Intronic
1021572865 7:22083160-22083182 CGCTGCCAGAGGGGAGGCTGCGG + Intergenic
1022697867 7:32728168-32728190 GGCCGCCGGAGAGGAGGCGGTGG + Intergenic
1023418148 7:39950847-39950869 GGCCGCGGCGGCGGCGGCTGCGG - Exonic
1023545351 7:41312529-41312551 AGAAGCAGCAGCGGAGGCTGAGG - Intergenic
1023868417 7:44249882-44249904 CTCCTCAGCAGGGGAGGCTGAGG - Intronic
1025615707 7:63114421-63114443 CGCTGCCGCGGCGGCGGCGGCGG + Intergenic
1025729988 7:64100444-64100466 CGCGGCCGCTGCGGGAGCTGCGG + Intronic
1027236506 7:76301636-76301658 CGCAGCTGCTGGGGAGGCTGAGG - Intergenic
1028709474 7:93890805-93890827 CCCCGCCGGGGCGGAGCCTGAGG + Exonic
1029280084 7:99429865-99429887 AGCTGCCCCAGAGGAGGCTGAGG + Intronic
1029701382 7:102248789-102248811 CCCCGGCGCGGCGGCGGCTGAGG - Exonic
1030739063 7:113086566-113086588 GGCCGCGGCGGCGGCGGCTGCGG + Intronic
1032174351 7:129611689-129611711 CGCCGCCGCCGAGGAGGGGGAGG - Intergenic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1032306229 7:130734181-130734203 GGCGGCGGCAGCGGCGGCTGCGG - Intergenic
1034596039 7:152193057-152193079 CGCAGCTGCATGGGAGGCTGAGG + Intronic
1035169538 7:157009945-157009967 CGCCGCCGCCGCCGCCGCTGGGG - Exonic
1036789499 8:11708668-11708690 GGCCGCGGCAGCGGCGGCGGCGG - Exonic
1038633037 8:29263225-29263247 CGGGGCCGCAGCGAAGGCGGGGG + Intergenic
1039957354 8:42217802-42217824 CGCCGCCCCTGCAGATGCTGCGG + Intergenic
1040107026 8:43547070-43547092 CGAGGCCGAAGAGGAGGCTGAGG - Intergenic
1040107205 8:43547750-43547772 CGCCACCAAAGAGGAGGCTGCGG - Intergenic
1041277320 8:56176163-56176185 CCCAGCTGCTGCGGAGGCTGAGG - Intronic
1043296210 8:78666284-78666306 CGCCGCGCCTCCGGAGGCTGGGG + Intronic
1043568274 8:81571468-81571490 GGCGGCAGCAGAGGAGGCTGAGG - Intergenic
1047499585 8:125431010-125431032 CGCCGACGACGCGGCGGCTGTGG + Exonic
1048072862 8:131040220-131040242 CCCGGCCGCAGCGGCTGCTGTGG - Exonic
1049460791 8:142726834-142726856 CGGCGCTGCAGCGGACTCTGCGG - Intergenic
1049548573 8:143246229-143246251 CGCCGCGGAGGCGGGGGCTGGGG + Intergenic
1049729014 8:144166457-144166479 CGCGTCCCCAGCTGAGGCTGTGG + Intronic
1052192792 9:25678180-25678202 CGCCGCCGCCGCCGCCGCTGGGG + Exonic
1053003315 9:34589685-34589707 GGCGGCGGCAGCGGAGGCGGCGG - Exonic
1053240053 9:36487770-36487792 CGCCCCCGGAGCCGCGGCTGAGG - Intergenic
1053393698 9:37753693-37753715 CCGAGCCGGAGCGGAGGCTGCGG - Intronic
1054798636 9:69325418-69325440 CGCGGCCGCAGCGGGGGCAGCGG - Intronic
1055514231 9:77020415-77020437 CGCCGCGGCCGCGGCGGCAGCGG - Exonic
1057313377 9:93954988-93955010 CGCCGCGGCAGCGGCGGCTGCGG + Exonic
1057361148 9:94374755-94374777 CGGCGACGCCGCGGAGGCGGCGG - Exonic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057662213 9:97013409-97013431 CGGCGACGCCGCGGAGGCGGCGG + Exonic
1058851103 9:109013061-109013083 CTCGGCAGCAGGGGAGGCTGCGG - Intronic
1060200939 9:121651563-121651585 CGGCCCCGCGGCGGGGGCTGGGG - Intronic
1060406069 9:123373678-123373700 CGCCGCGGCAGCCGAGGATCGGG - Exonic
1060700700 9:125747231-125747253 TTCCGCCGCCGCCGAGGCTGAGG - Intergenic
1061196662 9:129110569-129110591 CGCCGCCGCCGCCGCGGCTGGGG + Exonic
1061851662 9:133419546-133419568 CGAAGCAGCAGAGGAGGCTGAGG + Intronic
1061971524 9:134047925-134047947 GGCCCCCGCAGCGCCGGCTGTGG - Intronic
1062314799 9:135961344-135961366 CGCCGCCGCAGCAGCCGCCGGGG + Exonic
1062543917 9:137053469-137053491 TGCCGCCGCCCCGGAGGGTGCGG - Intronic
1062663055 9:137649663-137649685 AGCCACAGCAGCGGAGGCAGAGG + Intronic
1202790866 9_KI270719v1_random:89691-89713 CGCCGCGGCTGCGGGGACTGGGG + Intergenic
1203773673 EBV:61493-61515 CGCCCCCGCCGCGACGGCTGTGG - Intergenic
1203469882 Un_GL000220v1:111687-111709 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1203477703 Un_GL000220v1:155659-155681 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1185892793 X:3835586-3835608 AGCCGCCGCGGCGGATGCGGCGG - Intronic
1185897901 X:3874006-3874028 AGCCGCCGCGGCGGATGCGGCGG - Intergenic
1185903020 X:3912437-3912459 AGCCGCCGCGGCGGATGCGGCGG - Intergenic
1185915796 X:4034007-4034029 CCCAGCTGCTGCGGAGGCTGAGG - Intergenic
1186638130 X:11427754-11427776 CGCTGCCGCTGCGGAGCCGGTGG + Intronic
1188005495 X:25013541-25013563 CGCCGCGGCAGCCGCGGCCGCGG - Exonic
1188441564 X:30218780-30218802 CGCAGCCGCAGCAGCGGCAGTGG - Exonic
1189794349 X:44633344-44633366 CGCGGCAGCAGCGGCGGCGGTGG + Intergenic
1190881623 X:54495927-54495949 TCCCGCCGCAGCCGAGGCCGGGG + Exonic
1192657056 X:73003255-73003277 TGCGGCGGCGGCGGAGGCTGCGG + Intergenic
1192657113 X:73003459-73003481 CGCCGCCGCAGCGGAGGCTGCGG + Intergenic
1192665007 X:73079542-73079564 CGCCGCCGCAGCGGAGGCTGCGG - Intergenic
1192665064 X:73079746-73079768 TGCGGCGGCGGCGGAGGCTGCGG - Intergenic
1192847927 X:74925105-74925127 CGCGGCGGCGGCGGAGCCTGAGG - Exonic
1195668347 X:107449909-107449931 CGGCGGCGCAGCGGCGGCGGCGG - Intergenic
1196707294 X:118727537-118727559 CTCCGCCGCCCTGGAGGCTGGGG - Intergenic
1198807224 X:140504332-140504354 GGCCGCGGCAGCGGCGGCGGCGG + Exonic
1199977754 X:152904362-152904384 AGCCGCTGCAGCGGTGCCTGTGG + Intergenic
1200227783 X:154428668-154428690 CGCTGAGGCAGTGGAGGCTGAGG + Exonic
1201010844 Y:9547364-9547386 CGCACCCGCAGCAGCGGCTGCGG - Intergenic