ID: 1192667300

View in Genome Browser
Species Human (GRCh38)
Location X:73101483-73101505
Sequence CACTACCACCCCAGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192667294_1192667300 17 Left 1192667294 X:73101443-73101465 CCTTCTCCTTTCCAAAGGCAGAG No data
Right 1192667300 X:73101483-73101505 CACTACCACCCCAGGCCCTGAGG No data
1192667295_1192667300 11 Left 1192667295 X:73101449-73101471 CCTTTCCAAAGGCAGAGAAACAT No data
Right 1192667300 X:73101483-73101505 CACTACCACCCCAGGCCCTGAGG No data
1192667292_1192667300 30 Left 1192667292 X:73101430-73101452 CCTTTTTACTCTTCCTTCTCCTT No data
Right 1192667300 X:73101483-73101505 CACTACCACCCCAGGCCCTGAGG No data
1192667296_1192667300 6 Left 1192667296 X:73101454-73101476 CCAAAGGCAGAGAAACATCACTC No data
Right 1192667300 X:73101483-73101505 CACTACCACCCCAGGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192667300 Original CRISPR CACTACCACCCCAGGCCCTG AGG Intergenic
No off target data available for this crispr