ID: 1192669471

View in Genome Browser
Species Human (GRCh38)
Location X:73124993-73125015
Sequence AACCTACTCCAGCTTCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192669465_1192669471 25 Left 1192669465 X:73124945-73124967 CCTCTGTACTCCTCTATACTCTC No data
Right 1192669471 X:73124993-73125015 AACCTACTCCAGCTTCTCCCAGG No data
1192669468_1192669471 2 Left 1192669468 X:73124968-73124990 CCCTTCTTTTCTTTCTCTCCTGC No data
Right 1192669471 X:73124993-73125015 AACCTACTCCAGCTTCTCCCAGG No data
1192669469_1192669471 1 Left 1192669469 X:73124969-73124991 CCTTCTTTTCTTTCTCTCCTGCA No data
Right 1192669471 X:73124993-73125015 AACCTACTCCAGCTTCTCCCAGG No data
1192669467_1192669471 3 Left 1192669467 X:73124967-73124989 CCCCTTCTTTTCTTTCTCTCCTG No data
Right 1192669471 X:73124993-73125015 AACCTACTCCAGCTTCTCCCAGG No data
1192669466_1192669471 15 Left 1192669466 X:73124955-73124977 CCTCTATACTCTCCCCTTCTTTT No data
Right 1192669471 X:73124993-73125015 AACCTACTCCAGCTTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192669471 Original CRISPR AACCTACTCCAGCTTCTCCC AGG Intergenic
No off target data available for this crispr