ID: 1192673256

View in Genome Browser
Species Human (GRCh38)
Location X:73168448-73168470
Sequence GGTTACCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192673252_1192673256 22 Left 1192673252 X:73168403-73168425 CCAATGCTTAGTAACAGGCCAAG No data
Right 1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG No data
1192673253_1192673256 4 Left 1192673253 X:73168421-73168443 CCAAGAGCTGTCTCTCAAAAGAA 0: 15
1: 201
2: 219
3: 189
4: 415
Right 1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192673256 Original CRISPR GGTTACCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr