ID: 1192677962

View in Genome Browser
Species Human (GRCh38)
Location X:73219602-73219624
Sequence AGGGAGTGCAAAGTGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192677950_1192677962 30 Left 1192677950 X:73219549-73219571 CCATCCCAATCCCAGGCAGTGCA No data
Right 1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG No data
1192677954_1192677962 19 Left 1192677954 X:73219560-73219582 CCAGGCAGTGCAGCCCAGAGAGA No data
Right 1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG No data
1192677955_1192677962 6 Left 1192677955 X:73219573-73219595 CCCAGAGAGAGAATCTGTACACT No data
Right 1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG No data
1192677952_1192677962 25 Left 1192677952 X:73219554-73219576 CCAATCCCAGGCAGTGCAGCCCA No data
Right 1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG No data
1192677951_1192677962 26 Left 1192677951 X:73219553-73219575 CCCAATCCCAGGCAGTGCAGCCC No data
Right 1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG No data
1192677956_1192677962 5 Left 1192677956 X:73219574-73219596 CCAGAGAGAGAATCTGTACACTC No data
Right 1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG No data
1192677953_1192677962 20 Left 1192677953 X:73219559-73219581 CCCAGGCAGTGCAGCCCAGAGAG No data
Right 1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192677962 Original CRISPR AGGGAGTGCAAAGTGAGTGT GGG Intergenic
No off target data available for this crispr