ID: 1192682075

View in Genome Browser
Species Human (GRCh38)
Location X:73262809-73262831
Sequence TCACCTTTCTAGTTGATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192682075_1192682079 16 Left 1192682075 X:73262809-73262831 CCCTGAATCAACTAGAAAGGTGA No data
Right 1192682079 X:73262848-73262870 CCCCACATCCAAATTTATCAAGG No data
1192682075_1192682085 27 Left 1192682075 X:73262809-73262831 CCCTGAATCAACTAGAAAGGTGA No data
Right 1192682085 X:73262859-73262881 AATTTATCAAGGGCTCCTGGTGG No data
1192682075_1192682084 24 Left 1192682075 X:73262809-73262831 CCCTGAATCAACTAGAAAGGTGA No data
Right 1192682084 X:73262856-73262878 CCAAATTTATCAAGGGCTCCTGG No data
1192682075_1192682086 28 Left 1192682075 X:73262809-73262831 CCCTGAATCAACTAGAAAGGTGA No data
Right 1192682086 X:73262860-73262882 ATTTATCAAGGGCTCCTGGTGGG No data
1192682075_1192682081 17 Left 1192682075 X:73262809-73262831 CCCTGAATCAACTAGAAAGGTGA No data
Right 1192682081 X:73262849-73262871 CCCACATCCAAATTTATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192682075 Original CRISPR TCACCTTTCTAGTTGATTCA GGG (reversed) Intergenic