ID: 1192683440

View in Genome Browser
Species Human (GRCh38)
Location X:73278356-73278378
Sequence AACATCAGCACAGCCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192683436_1192683440 -9 Left 1192683436 X:73278342-73278364 CCACTTTCCCTATAAACATCAGC No data
Right 1192683440 X:73278356-73278378 AACATCAGCACAGCCCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192683440 Original CRISPR AACATCAGCACAGCCCAAGG TGG Intergenic