ID: 1192683440 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:73278356-73278378 |
| Sequence | AACATCAGCACAGCCCAAGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1192683436_1192683440 | -9 | Left | 1192683436 | X:73278342-73278364 | CCACTTTCCCTATAAACATCAGC | No data | ||
| Right | 1192683440 | X:73278356-73278378 | AACATCAGCACAGCCCAAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1192683440 | Original CRISPR | AACATCAGCACAGCCCAAGG TGG | Intergenic | ||