ID: 1192694270

View in Genome Browser
Species Human (GRCh38)
Location X:73398354-73398376
Sequence GGACCTTCATGGTCACACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192694264_1192694270 10 Left 1192694264 X:73398321-73398343 CCACAACCCTGGGGCACCATTAC No data
Right 1192694270 X:73398354-73398376 GGACCTTCATGGTCACACTCTGG No data
1192694260_1192694270 23 Left 1192694260 X:73398308-73398330 CCTAAGCTGTGTACCACAACCCT No data
Right 1192694270 X:73398354-73398376 GGACCTTCATGGTCACACTCTGG No data
1192694268_1192694270 -6 Left 1192694268 X:73398337-73398359 CCATTACTTTGTACTCTGGACCT No data
Right 1192694270 X:73398354-73398376 GGACCTTCATGGTCACACTCTGG No data
1192694265_1192694270 4 Left 1192694265 X:73398327-73398349 CCCTGGGGCACCATTACTTTGTA No data
Right 1192694270 X:73398354-73398376 GGACCTTCATGGTCACACTCTGG No data
1192694266_1192694270 3 Left 1192694266 X:73398328-73398350 CCTGGGGCACCATTACTTTGTAC No data
Right 1192694270 X:73398354-73398376 GGACCTTCATGGTCACACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192694270 Original CRISPR GGACCTTCATGGTCACACTC TGG Intergenic
No off target data available for this crispr