ID: 1192698327

View in Genome Browser
Species Human (GRCh38)
Location X:73442523-73442545
Sequence TAGGGTAAAAAGAATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192698327_1192698333 10 Left 1192698327 X:73442523-73442545 CCTTTCTCATTCTTTTTACCCTA No data
Right 1192698333 X:73442556-73442578 AGGCAGCTAGATCCGATGACAGG No data
1192698327_1192698328 -10 Left 1192698327 X:73442523-73442545 CCTTTCTCATTCTTTTTACCCTA No data
Right 1192698328 X:73442536-73442558 TTTTACCCTAATCCAGAACCAGG No data
1192698327_1192698336 15 Left 1192698327 X:73442523-73442545 CCTTTCTCATTCTTTTTACCCTA No data
Right 1192698336 X:73442561-73442583 GCTAGATCCGATGACAGGGTGGG No data
1192698327_1192698338 28 Left 1192698327 X:73442523-73442545 CCTTTCTCATTCTTTTTACCCTA No data
Right 1192698338 X:73442574-73442596 ACAGGGTGGGTATAGAGCCCCGG No data
1192698327_1192698335 14 Left 1192698327 X:73442523-73442545 CCTTTCTCATTCTTTTTACCCTA No data
Right 1192698335 X:73442560-73442582 AGCTAGATCCGATGACAGGGTGG No data
1192698327_1192698334 11 Left 1192698327 X:73442523-73442545 CCTTTCTCATTCTTTTTACCCTA No data
Right 1192698334 X:73442557-73442579 GGCAGCTAGATCCGATGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192698327 Original CRISPR TAGGGTAAAAAGAATGAGAA AGG (reversed) Intergenic
No off target data available for this crispr