ID: 1192705538

View in Genome Browser
Species Human (GRCh38)
Location X:73526067-73526089
Sequence CCTGTAGGATCCCTGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192705538_1192705547 9 Left 1192705538 X:73526067-73526089 CCTGGCTTCAGGGATCCTACAGG 0: 1
1: 0
2: 0
3: 42
4: 292
Right 1192705547 X:73526099-73526121 GAGGCTGCCGCTGCTGCCCCCGG 0: 1
1: 1
2: 9
3: 88
4: 696
1192705538_1192705543 -10 Left 1192705538 X:73526067-73526089 CCTGGCTTCAGGGATCCTACAGG 0: 1
1: 0
2: 0
3: 42
4: 292
Right 1192705543 X:73526080-73526102 ATCCTACAGGTCCCGGGGTGAGG 0: 1
1: 0
2: 1
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192705538 Original CRISPR CCTGTAGGATCCCTGAAGCC AGG (reversed) Intergenic
901362709 1:8716374-8716396 CCTGAAGGATCACTTGAGCCTGG + Intronic
902799150 1:18818639-18818661 CCTGTAGAATCCCTGAGAACTGG - Intergenic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
903453117 1:23468482-23468504 CCTGTGGGATGGCTGAATCCTGG + Intronic
903606904 1:24581496-24581518 CCTGTAAGTTCCCTGCAGGCAGG + Intronic
905695509 1:39970580-39970602 CCTGTGGGGTCCCTGGAGACTGG + Intergenic
906358219 1:45127535-45127557 CCAGGAGGATCCCTTAAACCTGG - Intronic
908198021 1:61765006-61765028 ACTGTATAATCCCTGTAGCCAGG + Intronic
908759608 1:67499624-67499646 GCAGGAGGATCCCTTAAGCCTGG - Intergenic
911147355 1:94565564-94565586 CATGTAAGCTCCCTGAAGCCAGG + Intergenic
911727772 1:101260151-101260173 GCTGGAGGATCACTGGAGCCAGG - Intergenic
912977489 1:114343726-114343748 GCTGGAGGATCCCTTGAGCCCGG - Intergenic
914430024 1:147612651-147612673 ACTGTAGGGTTCCTGAAACCTGG + Intronic
914862420 1:151397749-151397771 GCTGGAGGATCGCTGGAGCCGGG + Intergenic
915079770 1:153344267-153344289 CTTACAGGATCCCAGAAGCCAGG + Intronic
915166618 1:153951560-153951582 GCTGTGGGAGCCCTGAAGCTGGG + Exonic
916028818 1:160858949-160858971 ACTGTAAGATCCTTGAGGCCAGG - Intronic
916562509 1:165945292-165945314 CCTGTAGGTTCCCTGAAAGCAGG + Intergenic
916915050 1:169397448-169397470 CTTGTAGGATCCCATAAGCAGGG - Intronic
917133969 1:171770614-171770636 ACTGTCTGAACCCTGAAGCCTGG + Intergenic
917916995 1:179712035-179712057 ACTGTGAGATCCCTGAAGACAGG - Intergenic
919148374 1:193663505-193663527 ACTGTAAGATCCATGAAGACAGG + Intergenic
919988418 1:202691838-202691860 CCTGCAGGTTTCCTGGAGCCTGG + Intronic
920264934 1:204714796-204714818 CCTGTAATCTCCCTGAAGCCAGG - Intergenic
920365073 1:205444010-205444032 GCTGGAGGCTCCCTGAAGTCAGG + Intronic
922622713 1:227002659-227002681 CCTGGAGGAAGCCTGCAGCCAGG + Intronic
923827657 1:237517603-237517625 ACTGTAAGCTCCATGAAGCCAGG + Intronic
924290021 1:242526290-242526312 GCGGGAGGATCGCTGAAGCCTGG + Intergenic
1063476193 10:6330961-6330983 CCTGTTGGACCCCTGGAGCCTGG + Intergenic
1063476480 10:6333197-6333219 TCTGTTAGATCCCTGGAGCCTGG + Intergenic
1064044329 10:11998474-11998496 GCAGGAGGATCCCTGGAGCCTGG - Intronic
1065133985 10:22650347-22650369 GCTGGAGGATCCCTTGAGCCCGG - Intronic
1065874076 10:29982066-29982088 CCTTAAGTATCCCAGAAGCCTGG + Intergenic
1066467138 10:35662417-35662439 GCAGGAGGATCCCTGGAGCCCGG + Intergenic
1068602631 10:58971469-58971491 TCTGTAGGTTCCATGAGGCCAGG + Intergenic
1069483520 10:68805545-68805567 GCGGTAGGATCACTTAAGCCCGG + Intergenic
1070801207 10:79245362-79245384 CCAGTGGGCTCCCTGAAGGCAGG + Intronic
1071359181 10:84828633-84828655 CCAGTAGAAACCCTGAACCCTGG + Intergenic
1072965997 10:99973157-99973179 GCAGGAGGATCACTGAAGCCAGG - Intronic
1073329895 10:102663197-102663219 GCTGGAGGATCCCTTGAGCCTGG + Intergenic
1074905624 10:117860882-117860904 ACTGTAAGCTCCATGAAGCCAGG + Intergenic
1075060065 10:119250485-119250507 GCTGTAGGATGCCTGGAGCCTGG - Intronic
1075708278 10:124516032-124516054 CCAGTAGGATCCCTGAACTGGGG - Intronic
1075846760 10:125551157-125551179 CCGGTGGGAGCTCTGAAGCCAGG - Intergenic
1075869975 10:125764796-125764818 CTGGGAGGATCCCTTAAGCCTGG - Intergenic
1076367532 10:129931835-129931857 CCTGTAGGGTCCCTCCTGCCTGG - Intronic
1076766317 10:132635882-132635904 CCAGAAGGATAACTGAAGCCTGG + Intronic
1076947029 10:133658486-133658508 TCTGCAGGATCCCTGAAGGAGGG - Intergenic
1077211459 11:1372628-1372650 TCTGCAGCATCCCTGAAGCTGGG - Intergenic
1077407121 11:2387639-2387661 CCTGCAGGATTCTGGAAGCCAGG + Intronic
1077895938 11:6453458-6453480 ACTGTGAGATCCCTGAAGTCAGG - Intronic
1078906453 11:15692514-15692536 CCAGAAGGATCCCTGGAGCTGGG - Intergenic
1078996522 11:16706352-16706374 GCTGGAGGATCACTTAAGCCTGG + Intronic
1079002449 11:16769568-16769590 CCTGAAGGAGCCCTGAAAACAGG - Intergenic
1080050018 11:27850018-27850040 CATGTAAGTTCCATGAAGCCAGG + Intergenic
1080320953 11:31008498-31008520 CCTGTAGCAGCTCTGAAACCTGG - Intronic
1082808458 11:57464294-57464316 CCGGAAGGAACCCTGATGCCAGG + Intronic
1083293372 11:61702127-61702149 GCTGGAGGATCACTGAGGCCAGG - Intronic
1085411796 11:76295733-76295755 CCTATGGGGTCCTTGAAGCCTGG + Intergenic
1085684209 11:78606803-78606825 CCTGTAGGATTCCTGATGCAAGG - Intergenic
1087116239 11:94528122-94528144 CCTGTGGGAGGCTTGAAGCCAGG + Intergenic
1087756969 11:102064496-102064518 CATGAAGGATGCCTGGAGCCAGG - Intronic
1088461365 11:110086811-110086833 AATGTAAGCTCCCTGAAGCCAGG - Intergenic
1089325407 11:117653393-117653415 CCTGGGGCATCCCAGAAGCCTGG + Intronic
1089364587 11:117913729-117913751 CCTGAGACATCCCTGAAGCCTGG + Intronic
1090267283 11:125361215-125361237 ACTGTAGGATCCTTGAGGGCAGG - Intronic
1091305657 11:134534498-134534520 GCTGGAGGATCCTTGAGGCCAGG + Intergenic
1091773831 12:3171436-3171458 CCTTGAGGATCCCTTAACCCTGG + Intronic
1092601179 12:10066721-10066743 TCTGTAGACTCCCTGAAGCATGG + Intergenic
1093847533 12:23991267-23991289 GCAGGAGGATCCCTAAAGCCAGG + Intergenic
1094302428 12:28979901-28979923 CCTGGAAGATCGCTTAAGCCCGG + Intergenic
1096243420 12:49971577-49971599 GCTGCAGGGTCCCTGAAGGCAGG + Intronic
1096411772 12:51382256-51382278 ACTGTAGGATCCTTGAGGGCTGG - Intronic
1097013637 12:55970357-55970379 ACTGAAGGATCCTTGAAGCCTGG + Intronic
1097238805 12:57559003-57559025 TCTGGAGGATCCTTGAGGCCAGG - Intronic
1098289842 12:68947736-68947758 GCAGTAGGAGCCCTTAAGCCTGG - Intronic
1098956272 12:76693093-76693115 CCTGCAGGACCCAGGAAGCCCGG + Intergenic
1099572955 12:84348502-84348524 TCTGAGGGAGCCCTGAAGCCTGG - Intergenic
1100364644 12:93908619-93908641 ACTATAGGATCCCTGAAGGCAGG + Intergenic
1102405236 12:112667766-112667788 CTTGGAGGATCACTGAAGTCAGG + Intronic
1103429275 12:120868160-120868182 GCAGAAGGATCCCTTAAGCCTGG + Intronic
1103523439 12:121551437-121551459 GCTGGAGGATCCCTCGAGCCAGG - Intronic
1105323227 13:19346996-19347018 CCTGTAGGATCCTTGACTTCAGG + Intergenic
1108484561 13:50910494-50910516 CCAGTAGGATCACAGAAGCAGGG - Intronic
1112168663 13:96947295-96947317 CTTCTTGGCTCCCTGAAGCCTGG - Intergenic
1112397106 13:99043350-99043372 GCTGTAGGCTGCCTGAAGCCTGG + Intronic
1113364327 13:109662004-109662026 TCTGTATGATCTCTGAGGCCAGG - Intergenic
1114466650 14:22927935-22927957 GCTGTAGGATCACTGGAGCTCGG - Intronic
1114839955 14:26251817-26251839 CCTGTAGGCTTCCTCAAGCAGGG + Intergenic
1115031022 14:28794185-28794207 GCTGGAGGATCACTGGAGCCTGG - Intronic
1115708090 14:36018617-36018639 ACTGTAAGCTCCCTGAGGCCAGG + Intergenic
1115714748 14:36090770-36090792 CCTGTAAGCTCCCAGAAGGCAGG - Intergenic
1116645137 14:47518260-47518282 CCTGCAGTATCTGTGAAGCCTGG - Intronic
1117087683 14:52218570-52218592 GCAGGAGGATCCCTGGAGCCAGG + Intergenic
1118257869 14:64220860-64220882 CCTGCAGGAACCCTGACTCCAGG - Intronic
1120144176 14:80961269-80961291 ACTGTAAGATCCCTGCAGACAGG - Intronic
1121028959 14:90641388-90641410 ACTGTAGACTCCCTGAAGCCTGG - Intronic
1121543307 14:94744777-94744799 GCTGGAGGATCCCTTGAGCCCGG + Intergenic
1122217423 14:100213623-100213645 GCAGGAGGATCCCTTAAGCCTGG - Intergenic
1122220052 14:100232396-100232418 CCTGTAGACTCTGTGAAGCCAGG + Intergenic
1122254572 14:100467429-100467451 CCTGTTTCATCCCTGCAGCCGGG - Intronic
1122348303 14:101073727-101073749 CCTGTGGGATCTGTGAGGCCAGG - Intergenic
1122524252 14:102369480-102369502 CCTGGAGGATCCATTGAGCCCGG - Intronic
1123149748 14:106169752-106169774 GCAGGAGGATCCCTTAAGCCTGG - Intergenic
1124348407 15:28937602-28937624 TCAGTGGAATCCCTGAAGCCCGG - Intronic
1124475758 15:30033033-30033055 CCTGTTGGTTCCCTGAAACGTGG + Intergenic
1125035626 15:35121161-35121183 CCTGCAGGCTACCTGGAGCCCGG + Intergenic
1126034797 15:44536566-44536588 CCTCTGGGGTCCCGGAAGCCCGG + Intergenic
1126489855 15:49225210-49225232 CCTGAGGGAGCCCTGCAGCCCGG - Intronic
1128049927 15:64655214-64655236 CCTGTTGGATCACTGAGGTCGGG + Intronic
1129361614 15:75028112-75028134 ACTGTGTGCTCCCTGAAGCCAGG + Intronic
1130295192 15:82642451-82642473 GCTGAAGGATCCCTTAAGCCAGG + Intronic
1130911040 15:88270950-88270972 ACTCTAGGTTCCTTGAAGCCAGG + Intergenic
1133336305 16:5008753-5008775 CCTGCAGGGTCCCTGAGGCTGGG - Intronic
1133442519 16:5832629-5832651 CCTGTAAGTTCCCTGAAGGCAGG + Intergenic
1134511966 16:14855759-14855781 CCTGTAAGTTCCCTGAGGTCAGG + Intronic
1134699607 16:16254259-16254281 CCTGTAAGTTCCCTGAGGTCAGG + Intronic
1134972222 16:18540412-18540434 CCTGTAAGTTCCCTGAGGTCAGG - Intronic
1135402916 16:22178502-22178524 CATGTGGGCTCCCTGAAGCCTGG + Intronic
1136251758 16:29009775-29009797 CTTGGAGGACCCCTGATGCCAGG - Intergenic
1136525766 16:30829207-30829229 CCTGGATGCTCCCTGAAGCCAGG + Intergenic
1137054468 16:35736802-35736824 CCTGTAGGAGCCAAGAAGTCTGG - Intergenic
1137267341 16:46880181-46880203 GCAGGAGGATCACTGAAGCCTGG - Intergenic
1140196924 16:72862774-72862796 CTTGTAGGATCCCTGCAGTCGGG - Intronic
1140388532 16:74564145-74564167 GCGGGAGGATCCCTGAGGCCAGG - Intronic
1141553229 16:84819936-84819958 CTTGTAGGCTCCCCGGAGCCCGG - Intergenic
1141622818 16:85246183-85246205 TGTGTAGGGTCCCTGAAGCTGGG - Intergenic
1141663621 16:85454485-85454507 CCTGGAGCATCCATGCAGCCAGG + Intergenic
1142281541 16:89150737-89150759 CCTGCAGGAGCCCTGGAGCCAGG + Intronic
1142297465 16:89235205-89235227 CCTGGAGGGTCCCAGAAGCTTGG + Exonic
1142406094 16:89891120-89891142 CCTGGAGGAGCTCTGAAGGCTGG - Intronic
1143973500 17:10813051-10813073 ACTTTAGGCTCCCTGAAGGCAGG - Intergenic
1146901522 17:36592258-36592280 CCTCTCGGATCCCTTAAGGCAGG + Intronic
1148680265 17:49469819-49469841 CCTGGGTGATCCCTGGAGCCCGG + Intronic
1150468848 17:65418677-65418699 CCTGGTGGAAGCCTGAAGCCAGG - Intergenic
1151343060 17:73484275-73484297 CCCCTTGGTTCCCTGAAGCCTGG - Intronic
1151442084 17:74136008-74136030 CTTGTAGGAAACCTGAACCCGGG - Intergenic
1151546509 17:74796588-74796610 GCTGTAGGAGCCCTGTGGCCTGG + Intronic
1151808969 17:76424723-76424745 GCAGCAGGATCCCTTAAGCCAGG + Intronic
1153292393 18:3514382-3514404 AAAGTAGGTTCCCTGAAGCCTGG + Intronic
1155569669 18:27178567-27178589 GGTGTAGGATCCCAGAAGCAAGG - Intronic
1155888262 18:31234981-31235003 AATGTAGGCTCCCTGAAGCAGGG - Intergenic
1155932287 18:31720372-31720394 CCAGCAGGCTCCCTGAGGCCTGG + Intergenic
1156882565 18:42098482-42098504 ACTGTAAGTTCCCTGAAGGCAGG + Intergenic
1157241552 18:46014617-46014639 CCTGGAGGATCGCTTAACCCTGG + Intronic
1157428682 18:47605297-47605319 CCTGTTTGATTTCTGAAGCCGGG + Intergenic
1157744952 18:50127286-50127308 CCTGTAGGAACCAAGAACCCAGG + Intronic
1160773288 19:843423-843445 CCTGGGGGCTCCCTGACGCCTGG + Intronic
1161110769 19:2468597-2468619 CCTGGGGGATCACTGGAGCCAGG + Intergenic
1161982573 19:7637508-7637530 ACTCTAGGATCTCTTAAGCCGGG + Intronic
1162489168 19:10981745-10981767 GCTGGAGGATCCCTTGAGCCAGG + Intronic
1162545145 19:11324735-11324757 CTTCTGGGGTCCCTGAAGCCGGG + Exonic
1162680004 19:12333485-12333507 CCTGGAACATCCCGGAAGCCGGG - Exonic
1163111694 19:15165226-15165248 CCTGCAGGCTTCATGAAGCCTGG + Intronic
1163506306 19:17709082-17709104 CCTGGAGGATCCTTGAGGCCAGG + Intergenic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1164717790 19:30406097-30406119 CCTGAAGGATCTCTAAAGTCAGG + Intronic
1165354417 19:35294843-35294865 TCTGAAGGATCGCTTAAGCCTGG + Intronic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166628615 19:44384902-44384924 GCAGGAGGATCACTGAAGCCAGG + Exonic
1167345280 19:48941765-48941787 GGTGGAGGATCCCTGGAGCCTGG - Intronic
1167484486 19:49753657-49753679 GCAGGAGGATCCCTTAAGCCTGG + Intronic
1168394995 19:56040042-56040064 GCAGGAGGATCCCTGGAGCCTGG - Intronic
1168613780 19:57821466-57821488 CCTGGAGAATCTCTGAAGCCAGG + Intronic
1168617767 19:57852171-57852193 CCTGGAGAATCTCTGAAGCCAGG + Intronic
1168640062 19:58025138-58025160 CCTGTAGAGTCCCAGGAGCCTGG + Intergenic
926797108 2:16628036-16628058 CCAGTGGCATCCCCGAAGCCTGG - Intronic
926820350 2:16844995-16845017 TCTGGAGGATCACTGGAGCCCGG + Intergenic
928264203 2:29797549-29797571 ACTCTAGGATCCCTGAAGGCAGG + Intronic
929522605 2:42667978-42668000 CATGTATGATCCGTGTAGCCCGG + Intronic
929882875 2:45852538-45852560 CCTCTAGGAGCTCTCAAGCCAGG + Intronic
931519560 2:63080788-63080810 CCTGTAAGTTCCGTGAAGGCAGG + Intergenic
934494679 2:94787280-94787302 GCTGTAGGAGCCCTGATGCATGG + Intergenic
934886429 2:98029445-98029467 CCTGCAGGGTCCCTGAGGCCAGG + Intergenic
935113397 2:100112462-100112484 GCTGGAGGATCACTTAAGCCAGG + Intronic
936058936 2:109281982-109282004 CCTGGAGCATCCCGAAAGCCTGG - Intronic
936428397 2:112437493-112437515 CCTGGAGGAGCCCTGAGACCAGG - Intergenic
936541669 2:113356711-113356733 CCTGTAGGGTCCCTTCAGCAAGG + Intergenic
937821375 2:126314499-126314521 ACTGAAGGATCTGTGAAGCCAGG - Intergenic
939617336 2:144376225-144376247 CCTGTAAGATCCTTAAAGTCAGG - Intergenic
939924772 2:148159407-148159429 GCTGGAGGATCCCTTGAGCCTGG - Intronic
941378054 2:164755069-164755091 CCGGGAGGATCACTTAAGCCTGG + Intronic
941558024 2:167008063-167008085 GCTGCAGGCTCCATGAAGCCAGG + Intronic
942437694 2:175998974-175998996 CCTCTAAGACCCCTGAAGCAAGG + Intronic
942525690 2:176850382-176850404 CTTGCAGGTTCCCTGAAGCCAGG + Intergenic
943694497 2:190909942-190909964 GCTGGAGGATCACTTAAGCCTGG + Intronic
946726907 2:222670640-222670662 CCTGCAGGAGCCAAGAAGCCTGG + Intergenic
946830190 2:223720902-223720924 GCTGAAGGATCCCTTGAGCCAGG + Intergenic
947191722 2:227513458-227513480 CCTGTGGGATTTCTGTAGCCTGG + Intronic
947634127 2:231671607-231671629 CCAGGGGGATCCCTGAGGCCTGG - Intergenic
947745921 2:232507241-232507263 CCTGGAGGATTCCCGGAGCCAGG + Intergenic
948135000 2:235629769-235629791 TCTGGAGGATCCCTTGAGCCAGG + Intronic
948903327 2:240966799-240966821 TCTGTGGGAGCCCTGAAGCCAGG - Intronic
1170611923 20:17921511-17921533 GCAGGAGGATCACTGAAGCCAGG + Intergenic
1172122186 20:32604942-32604964 CCTGAAGGTCCCCTGAAGGCTGG + Intronic
1172665286 20:36594946-36594968 GCTGGAGGATCACTTAAGCCTGG + Intronic
1172869081 20:38124674-38124696 GCTGGAGGATCCCTTGAGCCTGG - Intronic
1173075789 20:39818036-39818058 CCTGAGGCATCCCTGAAGGCAGG - Intergenic
1173193716 20:40896447-40896469 TCTGTAGGATCCCAGAAGTGGGG + Intergenic
1173686740 20:44929166-44929188 GCAGGAGGATCCCTGGAGCCCGG + Intronic
1173787699 20:45806628-45806650 CCTGTGGGATCCCAGAATCACGG + Intronic
1174111086 20:48198304-48198326 TCTGTAAGCTCCCTGAAGCAGGG + Intergenic
1176106927 20:63393817-63393839 GCTGTATGCTCCCTGCAGCCGGG - Intergenic
1176373854 21:6077718-6077740 CCTGGAGGAGCCCTGAGACCAGG + Intergenic
1178041887 21:28648435-28648457 TCTGTAAGATCCCTGAGGACAGG + Intergenic
1178731075 21:35103292-35103314 CCTGTGGGCTCCCTGCACCCGGG + Intronic
1179183479 21:39064469-39064491 TCTCTAGGAGCCCTGAGGCCAGG + Intergenic
1179749623 21:43460525-43460547 CCTGGAGGAGCCCTGAGACCAGG - Intergenic
1181300927 22:21880600-21880622 GGTGGAGGATCCCTGGAGCCTGG + Intergenic
1181384599 22:22534850-22534872 CATGTGGGCTCCCTGAAGCCAGG + Intergenic
1181806898 22:25380346-25380368 CCAGGAGGATCCCTGACACCTGG + Intronic
1184727845 22:46356804-46356826 CCTGTGGCACCCCTGATGCCAGG + Intronic
950021959 3:9793382-9793404 CCTGTAGGAACCCGGAAGTGGGG + Intronic
953168107 3:40483114-40483136 GCTGGAGGATCCCTTGAGCCAGG + Intronic
955284266 3:57623822-57623844 CATGTAGGATCCATGAAGTCCGG + Intergenic
955448752 3:59043588-59043610 GGAGTAGCATCCCTGAAGCCTGG - Intronic
956408585 3:68954568-68954590 ACTGAAGGATCTCTGAAGCCAGG + Intergenic
956494513 3:69810234-69810256 CCTGCAGCATCCCTGAACACCGG - Intronic
957176829 3:76822226-76822248 ACTGTAAGATCCATGAAGGCAGG + Intronic
960844819 3:121995647-121995669 CCTGGAGCCTCCCTGAAGACAGG + Intronic
961528562 3:127525288-127525310 CCAGGAGGATCACTTAAGCCTGG + Intergenic
962171340 3:133104680-133104702 CCCTTTGGTTCCCTGAAGCCTGG + Intronic
962545293 3:136428350-136428372 GCTGTAAAGTCCCTGAAGCCAGG + Intronic
963407865 3:144890791-144890813 CCTGAAGGAACCCTGTAGACTGG + Intergenic
964535182 3:157713692-157713714 GCTGTAGGTTCCCTAAAGCTAGG + Intergenic
964589710 3:158347185-158347207 ACTGTAAGATCCTTGAAGTCAGG + Intronic
965940043 3:174168770-174168792 CCTGCAGGTTCCCTGATGGCAGG + Intronic
966705803 3:182912091-182912113 CATGTAGGAGCCCTGGAGTCTGG + Intronic
967110341 3:186287992-186288014 TCTGTAGGCTCACAGAAGCCAGG + Intronic
970367152 4:15371497-15371519 TCTGTAAGCTCCCTGAAGCCAGG - Intronic
971174388 4:24266716-24266738 CCTGCAGGATCTTTGCAGCCTGG - Intergenic
971525141 4:27607457-27607479 TATGAAAGATCCCTGAAGCCAGG - Intergenic
972562569 4:40241659-40241681 GCAGGAGGATCCCTGAGGCCAGG + Intronic
972595530 4:40526665-40526687 GCAGGAGGATCCCTGGAGCCAGG - Intronic
973296599 4:48529882-48529904 CCAGAAGGAACCCTGGAGCCTGG - Intronic
973872186 4:55177782-55177804 TCTGTAAGACCCCTGAAGCCAGG - Intergenic
976512852 4:85930923-85930945 CCTGTACGATGCCTGAAGACCGG + Intronic
976532214 4:86168417-86168439 CGTGTAGGACCCTTCAAGCCAGG - Intronic
976628140 4:87208458-87208480 CCTGTAGGATTGCTGGAGCCTGG - Intronic
977623883 4:99168571-99168593 CTTGTAGGATACTTGAAGTCTGG + Intergenic
977644674 4:99399552-99399574 GCAGTAGGATCCCTTGAGCCTGG + Intergenic
980242981 4:130201775-130201797 CCTGCTGGGTCCCTGAAGCTTGG - Intergenic
981016597 4:139980182-139980204 CATGAGGGATCCCAGAAGCCAGG - Intronic
981201459 4:141984127-141984149 CCTGTAGAAACCCTGGACCCAGG + Intergenic
982927939 4:161363347-161363369 GCAGGAGGATCCCTGAGGCCAGG + Intergenic
984370156 4:178853473-178853495 CCTGAGAGATCCCTGAAGGCAGG - Intergenic
984747687 4:183238857-183238879 TCTGTAAGATCCCTGAGGGCAGG + Intronic
985284812 4:188326270-188326292 GCTGTATCATCCCTGAAGCAAGG + Intergenic
987669807 5:20991378-20991400 CCTGCATGTTCCCTGAAGGCAGG - Intergenic
990899958 5:60739358-60739380 GCTGTGGGGTCCCTGATGCCAGG + Intergenic
991206232 5:64053006-64053028 CCTGTAGGCTCGTTGCAGCCAGG - Intergenic
991521514 5:67503318-67503340 TCAGTTGGATCCCTGAAGACAGG - Intergenic
992106000 5:73449106-73449128 CCTGTAGGAGCCTTCCAGCCGGG + Intergenic
992583311 5:78204689-78204711 CCTGGAGGATCCCTAATGCAAGG - Intronic
997691605 5:135831163-135831185 CCTGGAGCATCACAGAAGCCCGG - Intergenic
997710684 5:136001522-136001544 CCGGCAGGATGCCTGCAGCCAGG - Intergenic
998302097 5:141032567-141032589 CTTGTAGTACCCCTGGAGCCTGG - Intergenic
998430505 5:142065920-142065942 ACTGGAGGCTCCCTGAAGGCAGG - Intergenic
998825123 5:146093691-146093713 CCTGTAGACTCCCTGAAGCAGGG - Intronic
998939812 5:147269260-147269282 ACTGTAGGACCCCTGAAGGCAGG + Intronic
999424590 5:151476294-151476316 GCTGCAGGATCCCTGCAGGCTGG - Intronic
1002457038 5:179351165-179351187 CCTGCAGGCTCCCTGCAGCCAGG + Intergenic
1004235785 6:13873553-13873575 CCAGTAGGATCCCTCGGGCCGGG + Intergenic
1004958602 6:20758919-20758941 GCTGGAGGATTCCTGAGGCCAGG + Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1011155394 6:84324441-84324463 CCTGCAGAATCCCTAAAGCCAGG - Intergenic
1012059042 6:94453888-94453910 CCTGTATGGTCCCTAAACCCTGG - Intergenic
1014035076 6:116757653-116757675 CCTGCAGAATCCCTTGAGCCTGG + Intronic
1017892003 6:158646396-158646418 GCTGGAGGATCCCTTAAGCCCGG - Intergenic
1018371250 6:163170312-163170334 CCTGTAAAATCCCTGAGGGCAGG + Intronic
1019521215 7:1461334-1461356 CCTCCAGGGTCCCCGAAGCCAGG + Intergenic
1020236732 7:6361763-6361785 ACTGGAGGATCACTGAGGCCAGG + Intergenic
1021508690 7:21411956-21411978 CCTGTGGGCTTCTTGAAGCCAGG + Intergenic
1021801569 7:24311991-24312013 ACTGTAGGAGCTCTAAAGCCTGG + Intergenic
1022215126 7:28252072-28252094 ACTGGAGGATCCCTTGAGCCCGG + Intergenic
1022778812 7:33557086-33557108 TTTGTAGGAGACCTGAAGCCAGG - Intronic
1023290181 7:38660178-38660200 CCTGTAGGTCCCCTGATGGCAGG - Intergenic
1025227887 7:57179827-57179849 CCTGGAGGCACCCGGAAGCCCGG - Intergenic
1025987779 7:66470365-66470387 ACTGTAGAAACCCTGAGGCCTGG + Intergenic
1026225866 7:68439863-68439885 GCAGGAGGATCCCTTAAGCCTGG + Intergenic
1030278064 7:107741296-107741318 CCTGTAGGATCCTTGAAGTAGGG + Intergenic
1030821154 7:114093444-114093466 CATGTAGGTTCCATGGAGCCAGG + Intronic
1031836325 7:126685343-126685365 CTTGCAGGCTCCCTGAAGCATGG - Intronic
1032802329 7:135326982-135327004 CAGGTAGGGTCCCTGGAGCCAGG + Intergenic
1033647168 7:143314563-143314585 ACAGGAGGATCACTGAAGCCCGG - Intergenic
1034820989 7:154216139-154216161 CCCGTGGGGTCCCTGGAGCCAGG - Intronic
1035529545 8:339994-340016 CCTGTTGGCTCCATGAGGCCAGG - Intergenic
1036630695 8:10512535-10512557 CCTGTAGGATCCTTGAGGAAGGG - Intergenic
1039138227 8:34351999-34352021 CTTGTAGGATCCCTGACCGCAGG - Intergenic
1039778722 8:40762560-40762582 TCTGGAGGATCCCTTGAGCCTGG + Intronic
1046611668 8:116432563-116432585 CATGTAGGCTCCTTGAAGTCTGG - Intergenic
1048440057 8:134453144-134453166 CCTGTAGCATCACTGAGGGCTGG - Intergenic
1049126206 8:140791278-140791300 GCAGGAGGATCACTGAAGCCCGG - Intronic
1049481355 8:142825185-142825207 CCTGGAGGATCCCTGGCTCCAGG - Intergenic
1049814710 8:144592791-144592813 TCTGTGGGACCCCTGAGGCCAGG - Intronic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1053662441 9:40293079-40293101 GCTGTAGGAGCCCTGATGCATGG - Intronic
1053912896 9:42923254-42923276 GCTGTAGGAGCCCTGATGCATGG - Intergenic
1054374571 9:64439304-64439326 GCTGTAGGAGCCCTGATGCATGG - Intergenic
1054522169 9:66083205-66083227 GCTGTAGGAGCCCTGATGCATGG + Intergenic
1055099106 9:72445002-72445024 ACTGTAAGCTCCCTGAAGCCAGG + Intergenic
1055609173 9:78003979-78004001 CCTGTCAGATCCCTGAAGGCAGG - Intronic
1056292742 9:85160355-85160377 CCTGCAGCAGCCCTCAAGCCTGG + Intergenic
1056292882 9:85161326-85161348 CCTGCAGCAGCCCTCAAGCCTGG + Intergenic
1056298839 9:85221221-85221243 GCTGGAGGATCACTTAAGCCTGG + Intergenic
1057161804 9:92894524-92894546 GCTGTAGGAGCCCTGATGCATGG + Intergenic
1057246463 9:93459248-93459270 CCCGTAGGCTCCTTGAGGCCAGG + Intronic
1057678200 9:97152719-97152741 GCTGTAGGAGCCCTGATGCATGG + Intergenic
1057994616 9:99809489-99809511 CCAGTAGGATCGCTTGAGCCGGG + Intergenic
1058360734 9:104143259-104143281 CCTGTGGGATCCCTCAAGGGTGG + Intergenic
1059683070 9:116605223-116605245 CCAGTAGGCTCCCAGATGCCAGG + Intronic
1060506206 9:124200128-124200150 GCTGTAGCATCCCTTCAGCCTGG + Intergenic
1060556216 9:124508369-124508391 CCTATGGGATCCCTGGTGCCTGG - Intergenic
1061860667 9:133467195-133467217 CCAGGAGGATACCTGCAGCCTGG - Intronic
1062035037 9:134379232-134379254 CCTGTGGGCTCCCTGAGGGCGGG + Intronic
1062150132 9:135013903-135013925 CCTCCAGGAGCCCTGAGGCCAGG + Intergenic
1062281134 9:135752236-135752258 CCTTTAGGTCCCCAGAAGCCAGG - Intronic
1185787016 X:2899312-2899334 GCTGGAGGATCGCTTAAGCCTGG + Intergenic
1188082404 X:25860423-25860445 ACTGGGGGATACCTGAAGCCTGG - Intergenic
1188980373 X:36721702-36721724 TCTGAAGGAGCCCAGAAGCCCGG - Intergenic
1190093684 X:47462092-47462114 CCGGAAGGATCCCTTGAGCCCGG - Intronic
1192121432 X:68459814-68459836 CCAGAAGGATCGCTGAAGCCTGG + Intergenic
1192173167 X:68869297-68869319 CCTGTAAGCTCCATGAAGGCGGG + Intergenic
1192337376 X:70233394-70233416 GCTGGAGGATCACTTAAGCCTGG + Intergenic
1192705538 X:73526067-73526089 CCTGTAGGATCCCTGAAGCCAGG - Intergenic
1194406956 X:93508398-93508420 GCAGGAGGATCCCTTAAGCCAGG + Intergenic
1195297152 X:103490302-103490324 GCTGGAGGATCGCTCAAGCCTGG - Intergenic
1196472486 X:116044166-116044188 CCTGGAGGATGCCAGAAGCAAGG + Intergenic
1196777172 X:119349705-119349727 GCAGGAGGATCCCTTAAGCCCGG + Intergenic
1200137966 X:153884044-153884066 ACTGTAGGAGCCCTCAGGCCAGG + Intronic
1200706551 Y:6447819-6447841 CCTGAAGGGTCCCTGAGGTCGGG - Intergenic
1201027561 Y:9716889-9716911 CCTGAAGGGTCCCTGAGGTCGGG + Intergenic
1201287371 Y:12390748-12390770 TCTGGAGGATCGCTTAAGCCTGG - Intergenic