ID: 1192707404

View in Genome Browser
Species Human (GRCh38)
Location X:73541155-73541177
Sequence TTGGCTTCAGACTGCTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192707404_1192707413 3 Left 1192707404 X:73541155-73541177 CCAGCATAGCAGTCTGAAGCCAA No data
Right 1192707413 X:73541181-73541203 GGGAAGATCAAGTTTGGTGGGGG No data
1192707404_1192707411 1 Left 1192707404 X:73541155-73541177 CCAGCATAGCAGTCTGAAGCCAA No data
Right 1192707411 X:73541179-73541201 CTGGGAAGATCAAGTTTGGTGGG No data
1192707404_1192707410 0 Left 1192707404 X:73541155-73541177 CCAGCATAGCAGTCTGAAGCCAA No data
Right 1192707410 X:73541178-73541200 CCTGGGAAGATCAAGTTTGGTGG No data
1192707404_1192707408 -3 Left 1192707404 X:73541155-73541177 CCAGCATAGCAGTCTGAAGCCAA No data
Right 1192707408 X:73541175-73541197 CAACCTGGGAAGATCAAGTTTGG No data
1192707404_1192707415 7 Left 1192707404 X:73541155-73541177 CCAGCATAGCAGTCTGAAGCCAA No data
Right 1192707415 X:73541185-73541207 AGATCAAGTTTGGTGGGGGGAGG No data
1192707404_1192707412 2 Left 1192707404 X:73541155-73541177 CCAGCATAGCAGTCTGAAGCCAA No data
Right 1192707412 X:73541180-73541202 TGGGAAGATCAAGTTTGGTGGGG No data
1192707404_1192707416 27 Left 1192707404 X:73541155-73541177 CCAGCATAGCAGTCTGAAGCCAA No data
Right 1192707416 X:73541205-73541227 AGGTGCGTCTGCCATTACTGAGG No data
1192707404_1192707414 4 Left 1192707404 X:73541155-73541177 CCAGCATAGCAGTCTGAAGCCAA No data
Right 1192707414 X:73541182-73541204 GGAAGATCAAGTTTGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192707404 Original CRISPR TTGGCTTCAGACTGCTATGC TGG (reversed) Intergenic
No off target data available for this crispr