ID: 1192716529

View in Genome Browser
Species Human (GRCh38)
Location X:73648035-73648057
Sequence TCTCTTCCACACCTGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192716529_1192716532 -9 Left 1192716529 X:73648035-73648057 CCAGCCTCCAGGTGTGGAAGAGA 0: 1
1: 0
2: 1
3: 42
4: 359
Right 1192716532 X:73648049-73648071 TGGAAGAGAACCAGATGAATAGG 0: 1
1: 3
2: 25
3: 91
4: 425
1192716529_1192716533 -8 Left 1192716529 X:73648035-73648057 CCAGCCTCCAGGTGTGGAAGAGA 0: 1
1: 0
2: 1
3: 42
4: 359
Right 1192716533 X:73648050-73648072 GGAAGAGAACCAGATGAATAGGG 0: 1
1: 5
2: 31
3: 131
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192716529 Original CRISPR TCTCTTCCACACCTGGAGGC TGG (reversed) Intronic
900079399 1:844260-844282 TCTCTCACAACCCTGGAGGCTGG - Intergenic
900394649 1:2448258-2448280 TCTCTCGCAGTCCTGGAGGCTGG + Intronic
900674954 1:3879640-3879662 TCTCTCACAGTCCTGGAGGCTGG - Intronic
900863507 1:5250563-5250585 TATCTTCCCCATCTGCAGGCAGG + Intergenic
902799529 1:18820650-18820672 TCTCTCCGACACCTGCAGCCTGG + Intergenic
903071505 1:20729073-20729095 TCTCTTCCACGACTGGATGTGGG - Intronic
904374508 1:30071724-30071746 TCTGTACCCCACTTGGAGGCAGG - Intergenic
905253084 1:36662283-36662305 TCTCTCACAGTCCTGGAGGCTGG + Intergenic
905310395 1:37044949-37044971 TTTCTTTCACTTCTGGAGGCTGG - Intergenic
905851422 1:41277761-41277783 TCTCTCCCACACCTGGGGCCGGG - Intergenic
906660303 1:47577284-47577306 CATCTTCCACACCCAGAGGCAGG + Intergenic
906660720 1:47579462-47579484 TATCTGCCACACCCAGAGGCAGG - Intergenic
907198241 1:52704565-52704587 TCTCTACCCCACCTTGATGCTGG + Intergenic
908829153 1:68162692-68162714 TCTCTTCCACGGCTGCAGACGGG + Intronic
909542154 1:76803224-76803246 CCTCTTCCCTCCCTGGAGGCTGG + Intergenic
910805681 1:91188188-91188210 TCTCTTCCAAGCCAGCAGGCAGG + Intergenic
911812486 1:102300657-102300679 TTTCTTACAGATCTGGAGGCTGG - Intergenic
911895059 1:103422889-103422911 TTTCTTACAAATCTGGAGGCTGG - Intergenic
912231245 1:107795197-107795219 TCTGTTCCATTCCTGGAGACTGG - Intronic
912413303 1:109492194-109492216 TCACCTGCACACCTGGAGGTGGG - Intronic
913970945 1:143417242-143417264 TCTCTTCCCCAGCTTGAGTCTGG - Intergenic
914065323 1:144242853-144242875 TCTCTTCCCCAGCTTGAGTCTGG - Intergenic
914113828 1:144723501-144723523 TCTCTTCCCCAGCTTGAGTCTGG + Intergenic
914334380 1:146701295-146701317 TCTCTTCCCATTCTGGAGGCCGG + Intergenic
915250242 1:154582874-154582896 CCTCTTCCACTCCAGGAGACAGG + Exonic
917439329 1:175053129-175053151 TTTCTTGCACTTCTGGAGGCTGG + Intergenic
917500778 1:175583175-175583197 TCTCTTCCACACCCTTAGGGAGG - Intronic
918234487 1:182566340-182566362 TCTTTTCCACAAATGGAGGTGGG - Intergenic
918781219 1:188702884-188702906 TTTCTTCCAGTTCTGGAGGCTGG + Intergenic
919700870 1:200629832-200629854 CCTCTCCTCCACCTGGAGGCTGG - Intronic
920074062 1:203324320-203324342 TCTCTACCACACTAGGAGGTAGG + Intergenic
921954116 1:220964321-220964343 TTTCTTACAATCCTGGAGGCTGG + Intergenic
922160456 1:223075859-223075881 TCTCTTCCTGACTTGGTGGCTGG + Intergenic
922615956 1:226961367-226961389 TCTCTTCCAGCCCTGAAGGATGG + Exonic
922703235 1:227774546-227774568 TCTCACCTACACCTCGAGGCGGG - Intronic
922708557 1:227807310-227807332 TTTCTTACAGATCTGGAGGCTGG - Intergenic
922779198 1:228237982-228238004 CCTCTTCCATACCTTGAGGGAGG + Intronic
924265140 1:242273996-242274018 TTTCTTACAGACCTGGAGGTAGG - Intronic
924291264 1:242538670-242538692 TCTCTTCCATCCCTGCCGGCTGG - Intergenic
924947531 1:248856373-248856395 CCTCTTCCTCTCCTGGAGGTGGG + Exonic
1062882154 10:987966-987988 TCTGCTCCACACCCAGAGGCTGG + Intergenic
1064885921 10:20112172-20112194 TCTCTTACAATTCTGGAGGCTGG - Intronic
1064901653 10:20301926-20301948 TGTGTTCCCCACCTGGAAGCAGG + Intergenic
1065753530 10:28910125-28910147 TCCCTTCCTCACCAGGATGCAGG + Intergenic
1068658791 10:59602097-59602119 TTTGTCCCAGACCTGGAGGCTGG - Intergenic
1069183132 10:65388616-65388638 TTTCTTCCAGTTCTGGAGGCTGG + Intergenic
1069741678 10:70689007-70689029 TCACATCCACCCCTTGAGGCTGG + Intronic
1070695743 10:78561826-78561848 TTTCCTCCACAGCTGGAGGCAGG - Intergenic
1070922422 10:80196527-80196549 TCTCTCCCCCACCTCAAGGCAGG + Intronic
1072717802 10:97763057-97763079 TCTCTGGCACAGCTGGGGGCTGG + Intergenic
1075133269 10:119759076-119759098 TCTCATCCTCTGCTGGAGGCTGG + Intronic
1075400844 10:122160407-122160429 TTTCTTCCAGTTCTGGAGGCTGG + Intronic
1075777524 10:124998129-124998151 TCTCTTCCACGGCTGCAGACGGG + Exonic
1076547169 10:131253151-131253173 TCTCTTCAGCACCAGGAGCCCGG + Intronic
1076852743 10:133101073-133101095 TCTCCTCCTTACCCGGAGGCGGG - Intronic
1077042719 11:531648-531670 CCTCGTCCACTCCAGGAGGCAGG + Intergenic
1077258760 11:1604330-1604352 CCTCGTCCACTCCAGGAGGCAGG - Intergenic
1077336393 11:2006813-2006835 CCTCTCCCAGTCCTGGAGGCTGG - Intergenic
1078033745 11:7780954-7780976 GCTCTCCAAAACCTGGAGGCTGG - Intergenic
1079403739 11:20127355-20127377 TTTCTTCCAGATCTGGAAGCTGG - Intergenic
1080231522 11:30021630-30021652 TTTCTTACAGAGCTGGAGGCTGG + Intergenic
1080281331 11:30560846-30560868 TTTCTTCCACACCAGGTGGGGGG - Intronic
1080564239 11:33493383-33493405 TTTCTTACAGATCTGGAGGCTGG - Intergenic
1080875249 11:36269019-36269041 TCTCTTCCCCAGATTGAGGCAGG + Intergenic
1081023732 11:37982251-37982273 TCTCCGCCACACCTGGACCCCGG + Intergenic
1081233803 11:40620416-40620438 TCTCTTCCACGGCTGGAAGGAGG + Intronic
1081480254 11:43479781-43479803 CCTTTTCCACACCTAGAGGTGGG - Intronic
1081640651 11:44751164-44751186 TTTCTTCCACACTTGCTGGCAGG - Intronic
1082025659 11:47569689-47569711 TCTCTTCCACTCCTGGAACCAGG - Exonic
1082761418 11:57130598-57130620 TCTTTTCCACACCTTGATTCTGG - Intergenic
1083266195 11:61548010-61548032 TCTCTTCTACTCCATGAGGCTGG + Intronic
1085564736 11:77503186-77503208 TATCTTCCAGACCTGGAAGAGGG + Intergenic
1085766782 11:79290182-79290204 TCTCTTCTAGAGTTGGAGGCTGG - Intronic
1086738124 11:90332580-90332602 TCTCTTTCCAAGCTGGAGGCTGG - Intergenic
1089343960 11:117778280-117778302 GCTCTCCCATATCTGGAGGCAGG - Intronic
1090811739 11:130250356-130250378 TCTCTTCAGAACCTGCAGGCAGG - Intronic
1202819377 11_KI270721v1_random:61995-62017 CCTCTCCCAGTCCTGGAGGCTGG - Intergenic
1091446475 12:546628-546650 TCTCTTCCACACCTCTAGACTGG + Exonic
1091519043 12:1217538-1217560 TCTGTTCCACATTTAGAGGCAGG - Intronic
1091637144 12:2205768-2205790 TTTCTCACAGACCTGGAGGCTGG + Intronic
1091862558 12:3799206-3799228 TTTCTCACAGACCTGGAGGCTGG - Intronic
1093038978 12:14358039-14358061 TTTCTTACAGATCTGGAGGCCGG + Intergenic
1094364714 12:29668195-29668217 TTTCTTCTAGTCCTGGAGGCTGG + Intronic
1095043930 12:37477765-37477787 TTTCTTACACATCTGGAGGCTGG - Intergenic
1096104389 12:48988101-48988123 TCTCTTCCACAGCTGCACTCAGG + Intergenic
1096556324 12:52406234-52406256 TGACTGCCACACCTGGAGCCTGG + Exonic
1096797286 12:54085824-54085846 TCTCTCCCAAGCCAGGAGGCAGG + Intergenic
1097890576 12:64773404-64773426 GCTCTTCAACACCTAGAGGCTGG - Intergenic
1101074159 12:101111080-101111102 TCTCTTCCACACATATTGGCTGG - Intronic
1101476080 12:105049696-105049718 TCTCTTACAGTTCTGGAGGCCGG - Intronic
1102217099 12:111169347-111169369 TCTCTCCCGCTTCTGGAGGCTGG - Intronic
1102992768 12:117326953-117326975 TCTCTTCCAGAACTGGGAGCTGG - Intronic
1103736421 12:123063679-123063701 TTCCTTCCAGACCTGGAGCCTGG - Intronic
1104649796 12:130523348-130523370 TCTCTCTCAGTCCTGGAGGCTGG - Intronic
1104654242 12:130561208-130561230 TCTCTCCCAGTTCTGGAGGCTGG - Intronic
1104721536 12:131047348-131047370 TGTCCTCCGCACCTGGAGCCTGG + Intronic
1104758327 12:131282525-131282547 TCTCTTCCGCAGCGGGAGGCTGG - Intergenic
1105697923 13:22908845-22908867 TCTCTTACAGTTCTGGAGGCTGG + Intergenic
1105728106 13:23185838-23185860 TCACTTCCACAACTGAAGGAAGG + Intronic
1110522087 13:76491589-76491611 TCCCTTCCCCACCTAGAGGCAGG + Intergenic
1110753676 13:79146113-79146135 TCTCTTACAGTTCTGGAGGCTGG + Intergenic
1110950874 13:81489041-81489063 GCTCTTCTATACCTTGAGGCTGG + Intergenic
1111102229 13:83603385-83603407 TCTCTTACACTTCTGGAGGTCGG - Intergenic
1112212870 13:97398412-97398434 TCTCTTACAACTCTGGAGGCTGG + Intergenic
1112364575 13:98745721-98745743 TCTCTCACAGTCCTGGAGGCTGG - Intronic
1112764271 13:102724094-102724116 TTTCTTACAGATCTGGAGGCTGG - Intergenic
1113508022 13:110830606-110830628 TCTCTCCCAGCTCTGGAGGCTGG - Intergenic
1113981786 13:114282134-114282156 TCTCTTCCTCCCCTCGGGGCGGG - Intronic
1114486862 14:23068004-23068026 TCTCCTCCATCCCTGGAGGCAGG - Intronic
1114573399 14:23691727-23691749 TTTCTTCCAGTTCTGGAGGCTGG + Intergenic
1114723167 14:24904777-24904799 TTTCTTCCAGTTCTGGAGGCTGG - Intronic
1114739700 14:25082709-25082731 TTTCTCACACATCTGGAGGCTGG - Intergenic
1114790665 14:25654906-25654928 TTTCTTCCAGCTCTGGAGGCTGG + Intergenic
1115106676 14:29770153-29770175 TCTCTTACACTTCTGGAGACTGG - Intronic
1115961313 14:38837936-38837958 CCTCTTCCACACAGGGAAGCAGG + Intergenic
1118372958 14:65153318-65153340 TCTCCTCCCCACCCGGAGGCAGG + Intergenic
1119758267 14:77133809-77133831 CCCCTTCCGCACCTGGTGGCGGG + Exonic
1120493640 14:85207123-85207145 TTTCTTCCACTTGTGGAGGCTGG + Intergenic
1121183811 14:91949409-91949431 TCTCTCCCAGTTCTGGAGGCTGG + Intergenic
1121427325 14:93861749-93861771 TTTCTTCCAGTTCTGGAGGCTGG - Intergenic
1121587442 14:95072011-95072033 TATCTTCCTCTGCTGGAGGCGGG + Intergenic
1121813818 14:96914003-96914025 TCTCTCACACTTCTGGAGGCTGG - Intronic
1122150561 14:99723951-99723973 TTTCTCCCAGTCCTGGAGGCTGG + Intronic
1122280515 14:100619690-100619712 TCCCCTACACTCCTGGAGGCAGG + Intergenic
1122328935 14:100900011-100900033 TTTCTTGAACACCTGGGGGCCGG + Intergenic
1123118826 14:105907698-105907720 TCATTGCCAGACCTGGAGGCAGG - Intergenic
1202942473 14_KI270725v1_random:165398-165420 TTTCTTACACATCTGGAGGCTGG - Intergenic
1124438348 15:29669486-29669508 TTTCTTACACTTCTGGAGGCTGG - Intergenic
1126087399 15:45023065-45023087 CCTCCTCCAGACCCGGAGGCGGG - Intergenic
1126290944 15:47078098-47078120 TTTCTTACACATCTGGAGGCTGG + Intergenic
1126576660 15:50203940-50203962 TCTCTTGCAGTTCTGGAGGCTGG - Intronic
1127621473 15:60738768-60738790 TGTCTTACAGATCTGGAGGCTGG + Intronic
1128145023 15:65328266-65328288 TTTCTTTCACACCTGGAAACGGG + Exonic
1128252164 15:66171232-66171254 TTTCTGCCAGACCTGCAGGCCGG + Intronic
1128465782 15:67909881-67909903 TCTATTCCATTCCTGGAGGTTGG - Intergenic
1130046595 15:80450563-80450585 TCTCCTGACCACCTGGAGGCAGG - Intronic
1130141257 15:81228186-81228208 CCTATTCCACAGCAGGAGGCTGG + Intronic
1132209081 15:100007284-100007306 TCTGGTCCACACCTTAAGGCTGG + Intronic
1133895844 16:9928165-9928187 GCTCATTCACACCTGCAGGCAGG + Intronic
1134118699 16:11568576-11568598 TCTTCTCCACACCTGTTGGCTGG - Intronic
1137746278 16:50822590-50822612 TCTCTTACATTTCTGGAGGCAGG - Intergenic
1137762736 16:50953675-50953697 TCTCTCCCACTTCTGGAGACTGG - Intergenic
1139573676 16:67828386-67828408 TCTCTTCCTCCACTGCAGGCAGG - Exonic
1139999237 16:71009937-71009959 TCTCTTCCCATTCTGGAGGCCGG - Intronic
1140395322 16:74621354-74621376 TCTCTTTCACTTCTAGAGGCAGG - Intergenic
1140455027 16:75099995-75100017 ATTCTTCCACAGCAGGAGGCAGG - Intronic
1141771552 16:86092798-86092820 CCTCTCCCAGTCCTGGAGGCTGG + Intergenic
1142182083 16:88676221-88676243 TCTCCCCCAGTCCTGGAGGCTGG - Intergenic
1142484722 17:239153-239175 TCTCTCCCTCCCCTGGACGCTGG - Intronic
1142597022 17:1034851-1034873 TCTCCCCCACACCCGGCGGCAGG - Intronic
1143095437 17:4476248-4476270 CCTCAGACACACCTGGAGGCCGG - Intronic
1143321755 17:6072878-6072900 TCACATCCACACCAGGAGGCAGG - Intronic
1143392701 17:6569448-6569470 TGTCTCCCACACCTGGAAGCTGG - Intergenic
1143774505 17:9189167-9189189 TCTCTTCCACCCATGGAGCTAGG + Intronic
1143796165 17:9338497-9338519 TCTCTTCCAGTCATGGTGGCTGG + Intronic
1144256920 17:13477564-13477586 TTCCTTCCACCCCTGGAGTCTGG + Intergenic
1144423994 17:15123922-15123944 ACTCTTCCACCCATAGAGGCAGG - Intergenic
1144810321 17:17994639-17994661 TCTCTCCAGCAGCTGGAGGCAGG - Intronic
1146054396 17:29573942-29573964 TCCCTTCCCCACCTGGAGCCAGG - Exonic
1146944242 17:36863270-36863292 TCTGAGCCACACCTGGAAGCTGG + Intergenic
1148242727 17:46011055-46011077 TCTCTGCCACACCTCAACGCTGG - Intronic
1149444003 17:56699606-56699628 TCTCTGACACTCCTGGAGACGGG + Intergenic
1152265376 17:79291106-79291128 TTTCTTCCTCAACTGCAGGCTGG - Intronic
1152302428 17:79503083-79503105 TCTCTTCCACATGAGGATGCAGG - Intronic
1152393899 17:80020183-80020205 TCTCTGACAGCCCTGGAGGCAGG - Intronic
1156595509 18:38543562-38543584 TCTCTTACAGTTCTGGAGGCTGG + Intergenic
1158511938 18:58098259-58098281 TCCCTCCCACACCTGCAGGCTGG - Intronic
1158782044 18:60663418-60663440 TCTCTTCCACAGCTGCGGACGGG - Intergenic
1158858967 18:61573325-61573347 TTTCTTACAGTCCTGGAGGCAGG - Intergenic
1159597735 18:70399056-70399078 TTTCTTCCAACTCTGGAGGCCGG - Intergenic
1159680791 18:71349187-71349209 TTTCTTCCATTTCTGGAGGCTGG - Intergenic
1160354668 18:78216743-78216765 TTTCTTCCCCACGTGGAGGGAGG + Intergenic
1160963460 19:1735052-1735074 TCTCTCCCCCACCTCCAGGCAGG - Intergenic
1161455349 19:4367081-4367103 TCGCATCCACAGCTGGAGGCAGG + Intronic
1162029268 19:7910315-7910337 CATCTTCCACACCTGGCCGCAGG - Exonic
1162475996 19:10899592-10899614 TCTCTCCCACCCCAGGAGCCAGG - Intronic
1162712234 19:12604021-12604043 TCTCTTCCCTCCCTGGAGGTGGG - Intronic
1163632714 19:18425399-18425421 TCTCTTCCACACCTGGCAGGTGG + Intronic
1165488697 19:36110961-36110983 GCTTGTCCACCCCTGGAGGCTGG + Intergenic
1166459424 19:42973163-42973185 TCTCTCGCAGTCCTGGAGGCTGG + Intronic
1166476746 19:43133208-43133230 TCTCTCGCAGTCCTGGAGGCTGG + Intronic
1166901560 19:46067804-46067826 TGGTTTCCACACCTGGGGGCTGG - Intronic
1166948351 19:46411144-46411166 TCCCTCCCACACTTGGAGGGAGG + Exonic
1166989859 19:46685640-46685662 TCCTTTCCACACCTGAAGTCTGG + Intronic
1167551615 19:50165162-50165184 TTTCTTCCAGCTCTGGAGGCTGG + Intergenic
1167661709 19:50799346-50799368 GCCCTTCAGCACCTGGAGGCAGG + Exonic
1167961730 19:53111278-53111300 TATCTCCCAGACCTGGAAGCTGG - Intronic
1167976496 19:53231084-53231106 TTTCTTCCAGCTCTGGAGGCTGG + Intergenic
1168689069 19:58366199-58366221 GCTCTCCCTCTCCTGGAGGCTGG + Intergenic
925901600 2:8513091-8513113 TCACAACCACACCAGGAGGCAGG + Intergenic
926433779 2:12817579-12817601 TCTCTTACAGTTCTGGAGGCCGG - Intergenic
926625098 2:15084624-15084646 CATCTTCCACTTCTGGAGGCAGG + Intergenic
926727688 2:16011258-16011280 TTTCTTACACTTCTGGAGGCTGG - Intergenic
927198108 2:20561917-20561939 TCTCTTCCACCCCAGGAGGTTGG - Intronic
927289758 2:21393890-21393912 TTTCTTGCAGATCTGGAGGCTGG + Intergenic
927307300 2:21588262-21588284 TTTCTCCCACTTCTGGAGGCTGG - Intergenic
927698466 2:25252586-25252608 TCTCTTCCAGAGCTGGGGGAGGG - Intronic
928962019 2:36937010-36937032 TCTCTTCCGCAGCTTGAGTCTGG - Intronic
929973190 2:46603615-46603637 TCTCTTCCATAAGTGGTGGCAGG + Intronic
930876311 2:56221861-56221883 TTTCTTACACTTCTGGAGGCTGG + Intronic
933972072 2:87478112-87478134 TTTCTTACAGTCCTGGAGGCTGG + Intergenic
934175644 2:89578165-89578187 TCTCTTCCCCAGCTTGAGTCTGG - Intergenic
934285960 2:91652530-91652552 TCTCTTCCCCAGCTTGAGTCTGG - Intergenic
934691770 2:96366435-96366457 TCTCTTCCATACCAGGTGGCAGG + Intronic
934940598 2:98498918-98498940 TTTCTTACAGTCCTGGAGGCTGG - Intronic
934946676 2:98547425-98547447 TCCCTCCCACCCCTGGGGGCTGG - Intronic
936321655 2:111472085-111472107 TTTCTTACAGTCCTGGAGGCTGG - Intergenic
937649780 2:124307044-124307066 TCTCTTTCTCCCGTGGAGGCAGG + Intronic
939203048 2:139063059-139063081 TCTCTTCCCTTCCTGGAGGTGGG + Intergenic
939692224 2:145277863-145277885 TTTCTACCATACCTTGAGGCAGG - Intergenic
944657539 2:201891129-201891151 TCTCTTCCACTCCCGGAGCAGGG + Intronic
945453971 2:210027340-210027362 TATCTTCAACAGCTGGAGGATGG - Exonic
946344415 2:219096958-219096980 TCTCTTCTGAACCTGGAAGCTGG - Intronic
947998077 2:234545103-234545125 TCTCTTCACCACCAGGGGGCAGG - Intergenic
948040883 2:234900669-234900691 TCTCTTCCCTCCCTGGAGGGTGG - Intergenic
948551615 2:238776374-238776396 GCTTCTCCTCACCTGGAGGCTGG + Intergenic
948669969 2:239561938-239561960 CCTCTCCCAGTCCTGGAGGCTGG + Intergenic
1168804216 20:663184-663206 CCCCATCCACACCTGGACGCAGG - Exonic
1169542513 20:6615495-6615517 TCTCTTGCACCACTGTAGGCTGG - Intergenic
1170058022 20:12228588-12228610 TGTGTTCCACTCCTGGATGCTGG - Intergenic
1171492141 20:25527752-25527774 TCTCGTCCACTGCTGGAGGAAGG + Intronic
1171538458 20:25921350-25921372 TTTCTCACACATCTGGAGGCTGG - Intergenic
1171802675 20:29640075-29640097 TTTCTTACACATCTAGAGGCTGG + Intergenic
1171841407 20:30216636-30216658 TTTCTTACACATCTGGAGGCTGG - Intergenic
1172115776 20:32572716-32572738 TCTCCTCCAGATCTGGGGGCTGG + Intronic
1173573381 20:44093107-44093129 GCTCTTCCACTTCTGGAGGCTGG + Intergenic
1173574738 20:44105149-44105171 ACTCTTCCAAATCTAGAGGCAGG - Intergenic
1173907365 20:46638718-46638740 TCTCTCTGACACGTGGAGGCAGG - Intronic
1174378508 20:50141726-50141748 TCTCTCCCATCCCTGGGGGCAGG + Intronic
1174380171 20:50151207-50151229 TCTCCTCCAGACCTGGAGGTAGG - Intronic
1175966689 20:62663339-62663361 TCTCGGCCACACCTAGAGCCTGG - Intronic
1176139521 20:63538862-63538884 TCTAAGCCACACCAGGAGGCAGG + Intergenic
1176932822 21:14833261-14833283 TGTCTTCCAGTTCTGGAGGCTGG + Intergenic
1177658362 21:24049464-24049486 TCTCTTCCACATCGGGACGCAGG + Intergenic
1178100241 21:29260182-29260204 TTTCTTACATATCTGGAGGCTGG + Intronic
1178114265 21:29401168-29401190 TCTATTCCACACTTGGAGCAAGG - Intronic
1178134112 21:29606899-29606921 TCTCCTCCACAACTGGGTGCAGG + Intronic
1178199434 21:30387144-30387166 TGTCTTACAGTCCTGGAGGCTGG + Intronic
1179251559 21:39675127-39675149 TCTCTCACAGTCCTGGAGGCTGG + Intergenic
1179438037 21:41375416-41375438 TCTCTCACAGCCCTGGAGGCTGG + Intronic
1179728355 21:43353531-43353553 TCTCTTGCGCTGCTGGAGGCCGG - Intergenic
1181391157 22:22582009-22582031 TTTCTTACACTCGTGGAGGCTGG + Intergenic
1181833007 22:25578236-25578258 TCTCACCCACACCTGGAGTCAGG - Intronic
1183295552 22:37027324-37027346 TCACTGCCCCACCTTGAGGCAGG - Intronic
1183312081 22:37115692-37115714 TCTCTCCCAGTTCTGGAGGCGGG + Intergenic
1183493740 22:38130063-38130085 ACATTTCCACACCTGGAGGCCGG + Intronic
1183775225 22:39959712-39959734 TCTCTTCCGCAGCTGCCGGCAGG + Intronic
1184104991 22:42362344-42362366 TGTCTGCCTCTCCTGGAGGCTGG - Intergenic
1185346622 22:50313379-50313401 TCCCTTCCTCACCCGGAGGAGGG - Intronic
950171938 3:10844766-10844788 TTTCTCCCTCACCTGGAGTCTGG + Intronic
950556563 3:13699496-13699518 TCTGTTCCACCCCTGGCTGCAGG + Intergenic
951534850 3:23731207-23731229 TCTCTCACAGTCCTGGAGGCCGG + Intergenic
951925751 3:27907185-27907207 ACTCTTCCAAAGCTGGAGTCTGG - Intergenic
952748278 3:36802623-36802645 TTTCTTACAGTCCTGGAGGCTGG - Intergenic
952763994 3:36939512-36939534 TCTCTTCCAGGCCTGGTGTCAGG + Intronic
952957137 3:38564405-38564427 ACTCTTCCCCACATGGAGGAAGG - Intronic
953038862 3:39237350-39237372 TCTCTCACAGTCCTGGAGGCGGG - Intergenic
953192383 3:40700005-40700027 TTTCTTCCAGCCCTGGAGCCTGG - Intergenic
953203551 3:40799765-40799787 TTTCTTACACTTCTGGAGGCTGG - Intergenic
953210173 3:40868618-40868640 TCTCTTTCACCCCAGGATGCTGG - Intergenic
954661291 3:52228269-52228291 TCTCTTACAGTTCTGGAGGCTGG - Intergenic
954800367 3:53183664-53183686 TCGCCTCCTCACCTGGAGACGGG + Intronic
955692767 3:61606618-61606640 TTTCTTACACTTCTGGAGGCTGG + Intronic
956382552 3:68680636-68680658 TTTCTCACACATCTGGAGGCTGG + Intergenic
956996670 3:74833473-74833495 TCTGGTCCTCACCTAGAGGCCGG - Intergenic
958540802 3:95468786-95468808 TCTCTTCCAATCCTGGAGGATGG + Intergenic
960048397 3:113218786-113218808 TCTGTTGCAGAGCTGGAGGCTGG + Intronic
960859377 3:122135994-122136016 TCTCTTCCAGTTCTGGAGGCTGG + Intergenic
961556211 3:127698147-127698169 TCTCTGACACATCTGGTGGCTGG - Intronic
961830892 3:129622552-129622574 TCCCTGCCAGCCCTGGAGGCAGG + Intergenic
962712562 3:138100162-138100184 CCTCTTCCCTCCCTGGAGGCTGG - Intronic
962775447 3:138654990-138655012 ACTTTTCCACACCTGGGGGTTGG - Exonic
964704485 3:159603396-159603418 TCTCTTCCCTACCTGGAGGTTGG + Intronic
966306979 3:178547245-178547267 TTTCTTACACACCTGGAGGCTGG - Intronic
966853625 3:184179288-184179310 TCACATCCAGACCTGAAGGCTGG + Intronic
967641778 3:191874159-191874181 CCTCATCTACACCTGGAGGTTGG + Intergenic
967934419 3:194715455-194715477 TCTTATCCAGAGCTGGAGGCTGG - Intergenic
968284005 3:197497619-197497641 TGTCCTCCACTCCAGGAGGCAGG + Intergenic
969129260 4:4979444-4979466 TCTCTTACAGTTCTGGAGGCTGG - Intergenic
970881253 4:20934846-20934868 TCTCTCACAGCCCTGGAGGCTGG + Intronic
972342815 4:38167331-38167353 TTTCTTACACTTCTGGAGGCTGG + Intergenic
974364491 4:60928306-60928328 TCTCTTCCCAGCCTGGAGTCCGG - Intergenic
974511486 4:62848025-62848047 TTTCTTACAGATCTGGAGGCTGG + Intergenic
977873861 4:102125936-102125958 TTTCTTACACTCCTGGAGGCTGG - Intergenic
978051566 4:104206955-104206977 TGTTTTCCAGACCTGGAGTCTGG + Intergenic
979597977 4:122555513-122555535 TCCCTTCTACCCCTGGAGGAAGG - Intergenic
981046053 4:140266339-140266361 TTTCTTACAGACCTGGAGGCTGG + Intronic
981917394 4:150049824-150049846 TCTGCACCACTCCTGGAGGCTGG - Intergenic
985319035 4:188688384-188688406 CCTCTTTCTCACCTGGAGGTTGG - Intergenic
985732596 5:1557629-1557651 TCTCATCCACAGCTGGACGCAGG - Intergenic
986030476 5:3888685-3888707 TCTCTCCCACACCTGGAGATGGG - Intergenic
986530331 5:8730407-8730429 TCTCTGACACAGCTGGAGCCTGG + Intergenic
986688320 5:10293289-10293311 TTTCTTACAGTCCTGGAGGCTGG + Intronic
986847811 5:11776094-11776116 TCTCTTTCAGTTCTGGAGGCTGG - Intronic
988915474 5:35889780-35889802 TCTCTACCACACCTGGAAAACGG - Intergenic
991450575 5:66746530-66746552 TCTCTCCCAAAGCTGGAAGCAGG + Intronic
992778628 5:80108989-80109011 TGTCTTGCAGTCCTGGAGGCTGG - Intergenic
993724699 5:91354390-91354412 TTTCTTCCAGTTCTGGAGGCTGG + Intergenic
995026129 5:107424829-107424851 TCTCTTCCACCACTGCAGTCAGG - Intronic
998795621 5:145815263-145815285 TTTCTCACAGACCTGGAGGCTGG - Intronic
1000025216 5:157352968-157352990 TCTCTTCAGCTACTGGAGGCTGG - Intronic
1000616209 5:163430405-163430427 TCTGTTGCAGATCTGGAGGCGGG - Intergenic
1001362615 5:171103147-171103169 TCTCTTCCAAGCCGGCAGGCGGG + Intronic
1002121175 5:177006168-177006190 TCCCTTTCACACCTGGGGGGCGG - Intronic
1003567986 6:7236571-7236593 GCTCCTCCACCCCTGCAGGCAGG - Intronic
1004248273 6:14001389-14001411 TCTCATCCACATCCGGAGCCAGG + Intergenic
1004273311 6:14213417-14213439 TCCTTCCAACACCTGGAGGCTGG - Intergenic
1004465514 6:15881504-15881526 TCTCTCACAGTCCTGGAGGCTGG - Intergenic
1004570695 6:16841757-16841779 TGTATTCTGCACCTGGAGGCTGG - Intergenic
1005778695 6:29165642-29165664 TCTCTACCAGACCTGGATGTGGG - Intergenic
1006474264 6:34244765-34244787 CCTCTTCCACCCCCAGAGGCTGG - Intronic
1007384878 6:41513717-41513739 TCCCTGCCAGACCTGGAGGCGGG - Intergenic
1007800062 6:44384666-44384688 TCTCTTACAGTTCTGGAGGCTGG + Intergenic
1007830256 6:44632840-44632862 TCTCTCCCAGCTCTGGAGGCTGG + Intergenic
1008356410 6:50559032-50559054 TTTCTTACACTTCTGGAGGCAGG - Intergenic
1009924806 6:70107173-70107195 TGTCTTTCACACCTGAAGTCTGG - Intronic
1010823151 6:80440116-80440138 TCTCTGCCACACCTGGCAGCAGG + Intergenic
1011544665 6:88470081-88470103 TCTCTTCTATTCCTGGAGGATGG - Intergenic
1011709986 6:90043413-90043435 TTTCTTCCAGTTCTGGAGGCTGG - Intronic
1014812584 6:125903302-125903324 CCTCTGCCACACCTGGGGTCTGG + Intronic
1016758835 6:147715870-147715892 TCTCCTCCTCTCCTGGAGTCTGG + Intronic
1018064382 6:160115378-160115400 TGTCTTCCAGTTCTGGAGGCTGG + Intergenic
1018435130 6:163752441-163752463 TCTCTCCCTCACCAGGATGCTGG + Intergenic
1018825506 6:167405517-167405539 TCTCTCTCAGTCCTGGAGGCTGG - Intergenic
1019415027 7:923140-923162 TTTCTTCCAGCTCTGGAGGCTGG - Intronic
1019491301 7:1314782-1314804 ACTCCACCACAGCTGGAGGCAGG - Intergenic
1020684188 7:11273279-11273301 TTTCTTACACTCCTGGAGGCTGG + Intergenic
1023171318 7:37392586-37392608 TCTCTTCCACATCTGCTGCCAGG + Intronic
1023388387 7:39683142-39683164 TCTCTTACACTTCTGAAGGCTGG - Intronic
1024554391 7:50591091-50591113 TCACGTTCACACCTGGTGGCAGG - Exonic
1024984835 7:55186034-55186056 TCCCGTCCACACCGGGAGACAGG + Intronic
1025289856 7:57707318-57707340 TTTCTTACACATCTGGAGGCTGG - Intergenic
1025755815 7:64339515-64339537 TCTCTTCCACACTTGGGGCTGGG - Intronic
1026807930 7:73439338-73439360 TCTTCTCCAGAGCTGGAGGCTGG + Intergenic
1027999840 7:85479840-85479862 CTGCTTCCACACCTGTAGGCTGG - Intergenic
1030071061 7:105697928-105697950 CCTCTTCCACATATGGAGTCAGG - Intronic
1030656863 7:112178042-112178064 ATTCTTCCACATCTGGATGCTGG - Intronic
1032926818 7:136615596-136615618 CCTGTTCTACAGCTGGAGGCAGG + Intergenic
1033037239 7:137886107-137886129 TCTCTTACAGTTCTGGAGGCTGG - Intronic
1033208768 7:139444656-139444678 TTTCTTCCAGTTCTGGAGGCTGG - Intergenic
1034052382 7:147997112-147997134 TTTCTTACAGTCCTGGAGGCTGG - Intronic
1034801391 7:154058441-154058463 TCTCTTCCGCACCTGGCTGTTGG + Intronic
1034802577 7:154062691-154062713 TCTCTTCCGCACCTGGCTGTTGG + Intronic
1035032562 7:155870921-155870943 TGTCTTACAACCCTGGAGGCTGG + Intergenic
1035526227 8:315418-315440 TCTCTCACAACCCTGGAGGCTGG + Intergenic
1036126708 8:6069697-6069719 TATCTTGCAGTCCTGGAGGCTGG + Intergenic
1037625759 8:20605487-20605509 TTTCTTACAGTCCTGGAGGCTGG - Intergenic
1038418563 8:27416554-27416576 TATCTTCATGACCTGGAGGCAGG + Intronic
1040862085 8:52009038-52009060 TTTCTCACACTCCTGGAGGCTGG - Intergenic
1041042052 8:53857063-53857085 ACTCTTTCACAAATGGAGGCAGG - Intronic
1041447429 8:57967552-57967574 TTTCTTACAGATCTGGAGGCTGG - Intergenic
1041807902 8:61873730-61873752 TTTCTTACAGTCCTGGAGGCTGG - Intergenic
1042226826 8:66520855-66520877 TCTTTTCAACACCTGAGGGCTGG - Intergenic
1042481399 8:69307602-69307624 TTTCTTACAGTCCTGGAGGCTGG - Intergenic
1044618581 8:94166931-94166953 TCTCTCCTAGACCTGGAGGCTGG - Intronic
1046201495 8:110933920-110933942 TCTCTTCCAGACCTAGCCGCCGG - Intergenic
1046357810 8:113110836-113110858 TTTCTTACAGATCTGGAGGCTGG + Intronic
1047145339 8:122192560-122192582 TTTCTTACACTTCTGGAGGCTGG + Intergenic
1048418165 8:134250045-134250067 TTTCTCACAGACCTGGAGGCCGG - Intergenic
1048426679 8:134329765-134329787 TCTCTTACAGTTCTGGAGGCCGG - Intergenic
1048548859 8:135415016-135415038 TCTCTTTCCTACCTGCAGGCTGG + Intergenic
1049096720 8:140552618-140552640 ACTCTTGCACACAGGGAGGCTGG - Intronic
1049154808 8:141059968-141059990 TCTCTTGCAGCCCTGGACGCCGG + Intergenic
1049833981 8:144721231-144721253 TCTGTACCACACTTGGAGGCAGG + Exonic
1050643707 9:7695754-7695776 TCTTTTCAAGACCTGAAGGCTGG - Intergenic
1052014583 9:23450103-23450125 TCTCATCCACACCAAGGGGCAGG - Intergenic
1052221651 9:26031579-26031601 TTTCTTACAGATCTGGAGGCTGG + Intergenic
1053039914 9:34861956-34861978 TTTCTTGCAGTCCTGGAGGCTGG + Intergenic
1053154817 9:35769954-35769976 TCACTGCCAAACCTGGGGGCAGG + Intergenic
1053786856 9:41658401-41658423 TCTCTTCTAAGCCAGGAGGCAGG + Intergenic
1056278845 9:85020146-85020168 TCCCTTCCACACCTGGTTTCGGG + Intronic
1056699783 9:88892586-88892608 TTTCTTCCAGTCCTGGAAGCCGG - Intergenic
1056939251 9:90941213-90941235 GCTCTTTAACACCTGGAGGATGG - Intergenic
1058255159 9:102752675-102752697 TATCTTACACTTCTGGAGGCTGG - Intergenic
1059018501 9:110547629-110547651 TCTCTTCCAGACCTGAATGCTGG - Intronic
1059307549 9:113366687-113366709 TTTCTTCCCCACCTGTTGGCGGG + Intronic
1059567765 9:115400349-115400371 TTTCTTCCAGTTCTGGAGGCTGG + Exonic
1061014215 9:127972636-127972658 TCTCCTGCAGGCCTGGAGGCAGG + Intronic
1061079367 9:128360958-128360980 TCTCCTCCCCTCCTGGAGGTGGG - Exonic
1061082492 9:128380305-128380327 TGTCTGCCACACGTGGAGGCTGG + Intronic
1061191709 9:129086148-129086170 GCTGTACCACACCTGGAGCCAGG + Exonic
1185645791 X:1614762-1614784 TCTCTCACACTTCTGGAGGCTGG - Intergenic
1185714249 X:2328456-2328478 TCTCTCACAGTCCTGGAGGCTGG - Intronic
1185800648 X:3007524-3007546 TCTCTCACAGTCCTGGAGGCTGG + Intronic
1185873635 X:3684652-3684674 TCTCTCACAGTCCTGGAGGCTGG + Intronic
1185924723 X:4133500-4133522 TCTCTCACAGTCCTGGAGGCTGG + Intergenic
1186001032 X:5010827-5010849 TCTCTCACAATCCTGGAGGCTGG + Intergenic
1186009311 X:5111486-5111508 TCTCTCACAGCCCTGGAGGCTGG + Intergenic
1186186794 X:7028816-7028838 TCTCTTGCAGTCCTGGAGGCTGG + Intergenic
1186229626 X:7439247-7439269 TCTCTCACAGTCCTGGAGGCTGG - Intergenic
1186980499 X:14953280-14953302 TCTCTTACAGTTCTGGAGGCTGG + Intergenic
1187614403 X:20977440-20977462 TTTCTTACACTTCTGGAGGCTGG + Intergenic
1189283437 X:39835298-39835320 TCACTTACACATCTGGAGCCTGG - Intergenic
1189313402 X:40035807-40035829 ACTCTTCCCTACCTGGTGGCTGG - Intergenic
1190013223 X:46803473-46803495 TTTCTTACACTTCTGGAGGCTGG - Intergenic
1191900715 X:66038411-66038433 GCTTTTCCAGACCTGGAAGCAGG - Intronic
1192705072 X:73520685-73520707 TTTCTTACAAATCTGGAGGCTGG + Intergenic
1192716529 X:73648035-73648057 TCTCTTCCACACCTGGAGGCTGG - Intronic
1194557100 X:95373286-95373308 CTTCTTCTTCACCTGGAGGCAGG + Intergenic
1195331856 X:103809271-103809293 TCTCTTACAGTTCTGGAGGCTGG - Intergenic
1199845739 X:151692033-151692055 TGTCTTCCAGTTCTGGAGGCTGG + Intergenic
1200325982 X:155239917-155239939 TCTCTCCCAGTTCTGGAGGCTGG + Intergenic
1201671227 Y:16523007-16523029 TCTCTCACAGCCCTGGAGGCTGG - Intergenic