ID: 1192717747

View in Genome Browser
Species Human (GRCh38)
Location X:73661746-73661768
Sequence CTGAGCAGAAAAAGTTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 2, 1: 5, 2: 16, 3: 48, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192717747 Original CRISPR CTGAGCAGAAAAAGTTTCCA GGG Intronic
901343541 1:8517833-8517855 CTTAGAATAAAACGTTTCCATGG - Intronic
904320548 1:29695272-29695294 TTTTGCAGAATAAGTTTCCAGGG + Intergenic
907571371 1:55487243-55487265 CCCAGTAGAAAAAGTTTTCATGG - Intergenic
907662306 1:56404647-56404669 CTGAGCAGGCTAAGTTTTCAAGG - Intergenic
910338755 1:86162132-86162154 TTGATCTGGAAAAGTTTCCAAGG + Intergenic
910351373 1:86302233-86302255 GTGTGCAGAAGGAGTTTCCATGG - Intergenic
910557379 1:88550704-88550726 CTGACCAGAATGTGTTTCCATGG - Intergenic
910809243 1:91219187-91219209 CTGAGTGGAAAAGGTTTCCAGGG - Intergenic
911945709 1:104106039-104106061 CTGAGCTGATAAAGTATTCATGG + Intergenic
912585428 1:110760209-110760231 CTGAACAGAAAAATGTTTCAAGG + Intergenic
913072489 1:115312939-115312961 CTCAGTAAAAAATGTTTCCATGG - Intronic
913281039 1:117185359-117185381 TCCACCAGAAAAAGTTTCCATGG + Intronic
913465745 1:119140830-119140852 CTGAGCAGACAAGGGATCCAGGG - Intergenic
915116867 1:153606872-153606894 CAAAGCATAAAACGTTTCCAAGG + Exonic
915814413 1:158951469-158951491 CTGAGTGGAAAAAGTTTCCAAGG + Intronic
918797027 1:188913448-188913470 CTGAACATAAAAAGTTATCATGG + Intergenic
919642201 1:200056650-200056672 TTGAGCACTAATAGTTTCCATGG + Intronic
919943157 1:202302153-202302175 CAGAAAAGAAAAAGCTTCCATGG + Intronic
920956928 1:210628166-210628188 ATGAGGAGAAAAAGTATTCAAGG + Intronic
923852974 1:237817239-237817261 CAGAGGAGAAAAAGTCTCCTGGG - Intronic
924278910 1:242416669-242416691 TTTAGCTGAAAATGTTTCCAGGG - Intronic
1063094288 10:2895993-2896015 CTCAGCAGAAACAGCATCCAAGG - Intergenic
1063139370 10:3242969-3242991 CTGAGCAGAAAGAGCTGCCGGGG + Intergenic
1063481355 10:6379483-6379505 CTGGGAAGAAAAAGGTTCAATGG + Intergenic
1063506091 10:6600977-6600999 CTGGGGAGATAAAGATTCCAAGG - Intergenic
1063868366 10:10391477-10391499 CCGAGTAGAAAGAGTGTCCACGG - Intergenic
1064376520 10:14801481-14801503 CTGAGGAGAAAAAGTTTGGGGGG - Intergenic
1064909996 10:20390403-20390425 TTGAGTAGAAGAAATTTCCATGG - Intergenic
1067096420 10:43304192-43304214 CTGAGTTGAAAAAGTTTCTAAGG + Intergenic
1067860866 10:49846328-49846350 CTGACCAGAAAAAGGCTCAAGGG + Intronic
1071299258 10:84244392-84244414 CTGAGCATAAAAAATGTCCTAGG - Intergenic
1071404836 10:85319913-85319935 CTAAGCAGAAACTGTTTCCTGGG + Intergenic
1071461951 10:85906129-85906151 CAGAGCAGAAAAAAATACCAGGG + Intronic
1072441184 10:95456789-95456811 ATGAGCAGAACAAGTTTGCTGGG - Intronic
1073919037 10:108437991-108438013 CTAAGCAGACAAAATTTCCTTGG + Intergenic
1074590200 10:114805479-114805501 ATGGGAAGAAAAAGTTTCAAGGG - Intergenic
1075526912 10:123194649-123194671 CTGAGATGAAAATGTGTCCAAGG - Intergenic
1076892771 10:133292850-133292872 CTGACCAGTAAGAGCTTCCAGGG + Intronic
1077003262 11:335974-335996 CTGAGCATAAAGAGCTTCCCTGG + Intergenic
1079295216 11:19227007-19227029 CCAAACAGAAAAAGTTTACACGG + Intronic
1079458205 11:20655082-20655104 CTGACCAGAAACAGTCACCATGG - Exonic
1079492061 11:21000121-21000143 CTAAGTAGAAAAGTTTTCCAAGG - Intronic
1083013928 11:59431868-59431890 GTTATCAGACAAAGTTTCCAGGG - Intergenic
1084157324 11:67321148-67321170 CTGAGCAACAAAACATTCCACGG - Intronic
1086562087 11:88179273-88179295 CTGTGGAGAACAGGTTTCCATGG - Intergenic
1087254353 11:95937836-95937858 GTGAGCGGAAAAAGTTTCCAAGG - Intergenic
1089959782 11:122605979-122606001 CTCAGGAAAAAAAGTTCCCATGG - Intergenic
1090845551 11:130527149-130527171 CTCTCCAGAAAAAGTTTGCATGG + Intergenic
1091532772 12:1375486-1375508 GTCAGCAGAAAAAGTTGGCAAGG - Intronic
1091822429 12:3486101-3486123 CTCATCTGTAAAAGTTTCCAAGG + Intronic
1092446338 12:8560946-8560968 CTGAGCAGAAAAAGTTTCCAAGG + Intergenic
1092816894 12:12320285-12320307 CTGAGAAAAACAAGTATCCAGGG - Intergenic
1092818475 12:12331494-12331516 CTGAGCAGGAAAGGTTGGCAGGG + Intronic
1092874035 12:12832736-12832758 CTGAGCTGAAACAGCATCCATGG - Intergenic
1093268371 12:17027426-17027448 CTGAGCAGAAAAAGTGGGCCTGG - Intergenic
1093888431 12:24490215-24490237 CAGAGCAAGAAAAGTATCCATGG + Intergenic
1095461061 12:42444976-42444998 CTGAACAGAAAAAGTTTCTAGGG - Intronic
1095597726 12:43978401-43978423 CTGAACGGAAAAGGTCTCCAGGG + Intronic
1096434569 12:51577976-51577998 CTGGGAAGAAAAAATATCCATGG + Intergenic
1096457653 12:51800753-51800775 CTGAGCTGACAATGATTCCAGGG - Intronic
1098082669 12:66806187-66806209 ATGAGCAAAAAAAGGTTCAATGG + Intergenic
1098172590 12:67761807-67761829 CTTAGCTGAAATAGTTTCCTTGG + Intergenic
1098781024 12:74686711-74686733 ATGAGAAAAAAAAATTTCCAGGG + Intergenic
1099694589 12:86001762-86001784 CTGAGCTGAAATATTTTCCTTGG + Intronic
1099701145 12:86083712-86083734 CTGAGCAGAAAGACTTGGCAAGG - Intronic
1099857128 12:88181734-88181756 CTGAGCAGAAAAGGTCTCCAGGG + Intronic
1100158289 12:91827747-91827769 ATGAGAAGAAAGAGTGTCCAGGG - Intergenic
1100528837 12:95445978-95446000 CTGAGTGGAAAACGTTTCTAAGG + Intergenic
1100812554 12:98353683-98353705 TTGAGGAGAAAAATTTTCCTAGG - Intergenic
1102871165 12:116414897-116414919 ATGAGCAGAAAAAGACACCAAGG + Intergenic
1103253204 12:119518768-119518790 CTCAGCAGGAGAAGATTCCATGG - Intronic
1104145743 12:126032070-126032092 CTGAACGGAAAAGGTTTCCAGGG - Intergenic
1108457040 13:50626670-50626692 ATGAGCAGAAAAAGTTAGAAAGG + Intronic
1108878113 13:55073393-55073415 GTCAGCAGCAAAAGTTTCCATGG - Intergenic
1109169619 13:59079248-59079270 CTGAGGAGAAAAGGTGACCAAGG - Intergenic
1110059943 13:71028408-71028430 CTGAGTGGAAAAGATTTCCAGGG + Intergenic
1111245745 13:85537769-85537791 CTGGGCAATAAAAGTTGCCAAGG + Intergenic
1111332828 13:86782331-86782353 CTGAGATGAACTAGTTTCCAGGG - Intergenic
1111687340 13:91517721-91517743 CTGAGAAGAAAAAGTTTAATTGG + Intronic
1112758749 13:102670002-102670024 CTGAGCAGGAAAGGTCTCTAGGG + Intronic
1113184514 13:107672787-107672809 CTGAGGTAAAAAATTTTCCAAGG + Intronic
1116393198 14:44417764-44417786 CTGAGCAGAAAAGGTATCCATGG - Intergenic
1116697507 14:48195869-48195891 TTGAGCAGGAAAAGTATCAAGGG - Intergenic
1117621464 14:57591305-57591327 ATGATCAGAAAAAATGTCCATGG + Intronic
1118891200 14:69910759-69910781 CTGAGCAGACGGATTTTCCATGG + Intronic
1120103381 14:80468970-80468992 CTGAGCCGAAAAAGTTTCCAAGG - Intergenic
1120726534 14:87948032-87948054 CTTAGGAAAAAAAGATTCCAAGG - Intronic
1120962539 14:90138764-90138786 CTGAGAAGAAAAAGGCCCCATGG - Intronic
1123150647 14:106178278-106178300 GTGAGCACAAAAATTTTCAAGGG + Intergenic
1123159269 14:106262017-106262039 CTCAGGAGAAAAGGTTTGCAGGG - Intergenic
1123208037 14:106732616-106732638 CTCAGGAGAAAAAGTTTGCAGGG - Intergenic
1125745895 15:41997002-41997024 CTCAGCAGTAAAAGCATCCATGG + Intronic
1126543031 15:49842851-49842873 TTGAGCAGAAAAGATTTCTAGGG - Intergenic
1127346801 15:58109202-58109224 CTGTGCAGAACAAGTTCCCATGG + Intronic
1128053869 15:64685447-64685469 CTGGGCAGAAAAGGGTTACAAGG - Exonic
1130683079 15:86013618-86013640 CTGAGAAGAGAACTTTTCCATGG + Intergenic
1131318266 15:91361096-91361118 CTGAGCTGGAAAAATATCCAAGG - Intergenic
1132439312 15:101842688-101842710 CTTAGCAGATAAAATCTCCAAGG + Intergenic
1134410196 16:13997470-13997492 CTGCCCTGAAAAAGTTTACAAGG + Intergenic
1135186712 16:20321999-20322021 ATGAGCAGAAAGAGTCTTCAAGG + Intronic
1136661108 16:31763936-31763958 CTGAGCAGAAAAGGTCTCCAGGG + Intronic
1137062211 16:35801175-35801197 CTGAGTGGAAAAAGTTTCTAAGG - Intergenic
1137270894 16:46901709-46901731 CGGAGCAGAAAAAGTTGGCGGGG - Intronic
1137384936 16:48032741-48032763 CTGAGCAAAACAGGTTGCCAGGG - Intergenic
1137773933 16:51040543-51040565 CTGAGGAGACAAGGTCTCCATGG + Intergenic
1137970271 16:52977677-52977699 CTGAGTAGGGAAAGTTTCCTTGG - Intergenic
1138812117 16:60163554-60163576 GTTAGCAGAAAAAGCTTTCAAGG + Intergenic
1140738474 16:77920212-77920234 ATGAAAAGCAAAAGTTTCCAGGG - Intronic
1141021321 16:80499306-80499328 CTGAGTACAATCAGTTTCCAAGG + Intergenic
1141620046 16:85232493-85232515 CTGAGCAGGAAAAGCCACCAGGG - Intergenic
1141639879 16:85334918-85334940 CTGTGCAGATAAAGTCTCCCTGG - Intergenic
1143032367 17:3974780-3974802 ATGAGAAGAAGAAGTTTCCCAGG - Intergenic
1144022480 17:11249638-11249660 TTCTGCAGAAAATGTTTCCACGG + Intronic
1144165903 17:12610100-12610122 CTGGGCAAAAAAAGTTCCCAAGG - Intergenic
1144533524 17:16063977-16063999 CTGCGCACAAAAAGTTTTGATGG - Intronic
1144746558 17:17619466-17619488 CAGAGCAAGAAAAGTTTTCAGGG + Intergenic
1148866665 17:50632357-50632379 CTGCGCAGAAACAGTCTCCTCGG + Intergenic
1149270661 17:54973880-54973902 CTAACCAGAAAGAGTTTACAAGG - Intronic
1150268538 17:63847451-63847473 CTGAGCAGAATAAGTATCAAGGG - Intergenic
1153054182 18:929302-929324 CTGTGAAGAAGAGGTTTCCACGG - Intergenic
1153557270 18:6328715-6328737 CAGATTAGAAAAAGTTTCCGTGG - Intronic
1156795154 18:41035721-41035743 CTGAACTGAAAAAGTTTTAAGGG - Intergenic
1156796176 18:41048969-41048991 CTGAGTAAGAAAAGTTTCTACGG - Intergenic
1158171405 18:54604692-54604714 CTGAGTGGAAAAGGTTTCTACGG - Intergenic
1158442672 18:57490996-57491018 CTGTGCTGAAAGACTTTCCAGGG + Exonic
1160057393 18:75496361-75496383 TTCAGCAGAAAAGGCTTCCAGGG + Intergenic
1160873503 19:1287156-1287178 CAGAGCAAAAAAAGTTTGCCGGG + Intronic
1164259430 19:23556592-23556614 CTGAGTGGAAAAAGTTTCCAAGG - Intronic
1165138181 19:33684002-33684024 CTGGGCAGAGATAGTGTCCAGGG + Intronic
1165972531 19:39644174-39644196 CTGAGTGGAAATAGTTGCCAAGG - Intergenic
925646548 2:6043125-6043147 CTGAGCAGAAGAAGCTTCCCTGG - Intergenic
927084552 2:19661529-19661551 CTCAGAAGGAAAAGTTCCCATGG - Intergenic
927113441 2:19880247-19880269 CTGAGAAGAAAAAGCTTAGATGG - Intergenic
928664985 2:33541630-33541652 CTGAGCTGAATAACTTTCCATGG + Intronic
930938283 2:56982665-56982687 CTGAGTGGAAAAAGTTTCCAGGG + Intergenic
931184475 2:59936831-59936853 GAGAGCAGAAAGAGTTTGCAGGG + Intergenic
931244644 2:60481902-60481924 CTGAGCTGGAGAATTTTCCATGG - Intronic
931276515 2:60748286-60748308 CAGAGATGAAAAAGTTTCAATGG + Intergenic
931839455 2:66132916-66132938 ATGAGCATAAAATGTCTCCATGG + Intergenic
932473727 2:71985228-71985250 CAGAGCAAAGAAAGTTACCAGGG - Intergenic
933986649 2:87597174-87597196 CAGAGCAGGAGACGTTTCCATGG + Intergenic
934518526 2:95004798-95004820 CTGATTACAAATAGTTTCCAGGG + Intergenic
934750834 2:96793157-96793179 CTGGGCAGAAAGGGCTTCCAGGG + Intronic
936307193 2:111353635-111353657 CAGAGCAGGAGACGTTTCCATGG - Intergenic
937949643 2:127374158-127374180 CTGAGTGGAGAAAGTTTCTAAGG - Intronic
938917741 2:135960015-135960037 CTGTGCAGATAAAATTTCTAGGG + Intronic
939991798 2:148882719-148882741 CTGATCAGAAAAAGTGTCAGAGG - Intronic
940679020 2:156760835-156760857 CTGAGGATAAAACGTTTCTATGG + Intergenic
940780535 2:157928942-157928964 CCAATCAGAAAAAGATTCCATGG + Intronic
940797454 2:158095523-158095545 CAGAGTAGAAAGAGTTTTCATGG + Intronic
941451896 2:165670135-165670157 CTGAGCAACAATAGTTTCAAAGG - Intronic
941844079 2:170116291-170116313 CTGAGCGGAAAAAGTTTCCAAGG - Intergenic
942093464 2:172516262-172516284 CTGAGTGGAAAAAGTTTCCAAGG - Intergenic
947302054 2:228698943-228698965 CTGAAAAGCAAAAGTCTCCAGGG - Intergenic
947900593 2:233718367-233718389 ATGAGAAGAAAGAGTTTCAAGGG + Intronic
1169641514 20:7757460-7757482 GTGAGAAGAAAGAGTCTCCAGGG - Intergenic
1170550470 20:17471902-17471924 CTGCACAGAAACAGCTTCCAAGG + Intronic
1172901386 20:38337291-38337313 CTGAGTCGAAGAAGTTTGCAAGG - Exonic
1173672401 20:44807924-44807946 CTGTGTAGAAAATGTTTCCCAGG - Intronic
1175800152 20:61796837-61796859 CCGAGCAGAAACCGTTTCCAGGG + Intronic
1176214763 20:63942788-63942810 CTGAGAGGAAAAACTTTCCAGGG - Intronic
1176588537 21:8616158-8616180 CAGAGCAAAGAAAGTTACCAGGG + Intergenic
1181885865 22:26022039-26022061 GTGGGCAGAAGAAGTCTCCAAGG + Intronic
1182577851 22:31285202-31285224 CTGCTCAGGAAAAGTTCCCAAGG + Intronic
1183762260 22:39832503-39832525 TTAAGCAGAAAAAGTGTTCAAGG + Intronic
1183919290 22:41151449-41151471 CTCACCAGAGAAAGTTTCAAAGG - Intronic
1184249088 22:43250141-43250163 CTGAGCAAGCAAAGCTTCCAGGG + Intronic
1184942473 22:47779267-47779289 CTGAGAAGAAAAACATTCCAAGG - Intergenic
949282934 3:2367808-2367830 CAGAGAAAAAAAAGTTTCAATGG - Intronic
949405475 3:3709385-3709407 GTGAGCACAAATAGTTTCAAGGG + Intronic
949463122 3:4315497-4315519 CTGAGGACAAAAAATTTCCAGGG - Intronic
949523401 3:4878397-4878419 AAGAGCAGAAAAAGAATCCAGGG + Intronic
949628142 3:5891220-5891242 GTAAGAAGAAAAAGTTTCCAAGG + Intergenic
949628276 3:5892685-5892707 GTAAGAGGAAAAAGTTTCCAAGG + Intergenic
949632859 3:5947794-5947816 CAGAGCAGAAAAAGTGCCCGTGG - Intergenic
949742003 3:7246380-7246402 CTTCACAGACAAAGTTTCCAGGG - Intronic
949876483 3:8629253-8629275 CTGAGCAGGTAAAGTTTGGAAGG - Intronic
951250727 3:20391480-20391502 CAGAGCAGAAAAAGAGACCAAGG + Intergenic
951338141 3:21450010-21450032 GTGAGAAGAAAAAGGTCCCAGGG + Intronic
951590512 3:24259385-24259407 CTGAGCACTAATAGTGTCCATGG - Intronic
953487555 3:43316703-43316725 CACATCAGAAAAAATTTCCAAGG - Intronic
955118427 3:56030576-56030598 CAGAGCAGAAAAAATTACTATGG - Intronic
956586864 3:70874581-70874603 CTTTGTAGAAAAAGCTTCCAGGG - Intergenic
956660421 3:71591904-71591926 TTGAGCAGAAAGAGTATGCAAGG - Intergenic
956887912 3:73578969-73578991 CTGAAGACAAAAATTTTCCAAGG + Intronic
957603033 3:82362886-82362908 TGGAGCAGAAAAAGCTTCCATGG - Intergenic
961581832 3:127889582-127889604 CTAAGCACAAAAAGTTCTCAGGG - Intergenic
962023665 3:131526159-131526181 GTGGGCAGAAAAAGTGTGCAAGG + Intergenic
962375714 3:134857210-134857232 CTGAGCACAAAGAAATTCCAAGG - Intronic
963575276 3:147053086-147053108 CTGAGAAAAGAAATTTTCCATGG - Intergenic
966140017 3:176746602-176746624 TTCAGAAGAAAAAGTTTCTATGG - Intergenic
966551971 3:181215474-181215496 CTTAGCAGAAAAAGATTAGATGG - Intergenic
969359194 4:6650966-6650988 CTGGGCAGAAAAATTTTGCAGGG + Intergenic
969504769 4:7578428-7578450 GTGACCAGAAAAACTTTCAAAGG - Intronic
969747006 4:9080380-9080402 CTGAGCTGAAAGAGTTCTCAGGG + Intergenic
971444791 4:26731709-26731731 CTGAGCAGCAAAAGTTTCTGTGG + Intronic
971670789 4:29554205-29554227 CTCTGCAGAAAAAGTCACCATGG - Intergenic
972594075 4:40514916-40514938 CTGAGCTGAAAAACTGTCAAAGG + Intronic
973235827 4:47903175-47903197 CTAATTAGAAAAAGTTACCAAGG + Exonic
973253701 4:48087082-48087104 CTAAGAAGAAAAAGTATCAAGGG - Intronic
974459001 4:62163917-62163939 CTGAGCAGACATTGATTCCAGGG + Intergenic
974467630 4:62277534-62277556 CTTAGCTGAAAAATTATCCAAGG - Intergenic
976445590 4:85127256-85127278 CTGAGTGGAAAAATTTTCCAAGG + Intergenic
977092206 4:92691724-92691746 CTTAGAATAAAAAGTTTCCCAGG - Intronic
977701303 4:100026049-100026071 ATGAGCAGAAAATGATTCCTAGG + Intergenic
978100340 4:104831672-104831694 TTAAGCAAAAACAGTTTCCATGG - Intergenic
978208970 4:106112544-106112566 CTGAATGGAAAAAGTTTCCAAGG - Intronic
978941512 4:114441388-114441410 CCTAGTAGAAAAAGTTTCTAAGG + Intergenic
979947655 4:126853601-126853623 CTGAAGAGAATATGTTTCCAAGG - Intergenic
980146136 4:128986546-128986568 CTGAGCAGAAAGAGTCTCTTTGG - Intronic
980444998 4:132893809-132893831 CTGCACAGAAAAGATTTCCAGGG + Intergenic
980526231 4:133993984-133994006 CTGAGTGGAAAAGGTCTCCAAGG + Intergenic
980628882 4:135408761-135408783 CTGAGTGGAAAAACTTTCCAAGG - Intergenic
982668701 4:158295529-158295551 CTGAGTGGAAAAAATTTCCAGGG - Intergenic
982868241 4:160544283-160544305 CTGAGGAGAAAATGGTTTCATGG - Intergenic
983706712 4:170669586-170669608 CTGAGCAGAAGAAATTTTGAAGG - Intergenic
984327964 4:178276965-178276987 CAGGTCAGAAAAAGCTTCCATGG - Intergenic
984477033 4:180248822-180248844 ATGATCAGAAATAGTATCCAGGG + Intergenic
984580399 4:181503695-181503717 TTGAGCAGAGAAAGTTTCCTGGG - Intergenic
985346063 4:189005706-189005728 TTGAGCTGAGAAAGCTTCCAAGG - Intergenic
985357404 4:189136306-189136328 CTGAGCACAAAAGGATTGCAGGG + Intergenic
988327107 5:29784010-29784032 CTGAACATAAAATGTTTCCTGGG - Intergenic
989028272 5:37090753-37090775 CTGAGTGGAAAAAGTTTCTAAGG - Intergenic
993744155 5:91575413-91575435 CTGGGCAGAAACAATTTTCAAGG - Intergenic
993885759 5:93412991-93413013 CTCAGCAGCATAGGTTTCCAGGG - Intergenic
994681518 5:102893736-102893758 TGGAACAGAAATAGTTTCCAGGG + Intronic
995181434 5:109234365-109234387 CTGAACACACAAAGTTCCCAGGG - Intergenic
996978132 5:129459714-129459736 CTGACCAGAAAAAGGGACCAAGG - Intergenic
998529207 5:142869520-142869542 CTGAGCAGCAAAACATTTCAAGG + Intronic
998928023 5:147148785-147148807 CTGAGCAGTTAGAGTTTCCTTGG + Intergenic
999831264 5:155322490-155322512 ATGAGCAGAACAAATTTTCATGG + Intergenic
1003471598 6:6440726-6440748 GTCAACAGAAAAAGTTCCCAAGG + Intergenic
1003559903 6:7171837-7171859 CTGAGCAGAAAGGGTAACCAAGG + Intronic
1003566438 6:7226717-7226739 CTGAGGAGAGGAAGTTCCCATGG - Intronic
1004277350 6:14250191-14250213 TTTAGCAGAAAAAATTTCTAAGG - Intergenic
1004576945 6:16905707-16905729 CTGAGCACAAAAGGTTTGCTAGG - Intergenic
1004742760 6:18478026-18478048 CAGAGAGCAAAAAGTTTCCATGG - Intergenic
1005186173 6:23165198-23165220 CTGAGCAGAAAAAGTTCTCAAGG - Intergenic
1005320367 6:24646870-24646892 ATGAGCAGAAAAGGTAGCCAGGG + Intergenic
1006281041 6:33053530-33053552 CTGAGTAGAAAAAGTTTCCAAGG - Intergenic
1008304865 6:49888695-49888717 CTGAGTGGAAAAAGTTTCCAGGG + Intergenic
1008340072 6:50353561-50353583 CTGCCCACAAAAATTTTCCACGG - Intergenic
1008943527 6:57072616-57072638 CTGAGTGGAAAAAGTTTCCAGGG - Intergenic
1010110277 6:72219750-72219772 CTCAGAAGAACAAGTTTCAAGGG - Intronic
1010626031 6:78137233-78137255 CTGAGTGGAAAAGGTCTCCAGGG - Intergenic
1012323344 6:97880797-97880819 TTGAGAAGAAACAGTTCCCATGG + Intergenic
1012588286 6:100949120-100949142 CTGAGTGGAAAAAGTTTCCAAGG - Intergenic
1013540627 6:111104564-111104586 ATGAGGAGAAAGAGTTGCCAGGG + Intronic
1013569249 6:111404331-111404353 GTGAGCAGAAATAGTTTGAAAGG - Intronic
1014561475 6:122896200-122896222 CAGATCAGAAAAAGTTTCAAAGG - Intergenic
1014670686 6:124301004-124301026 CAAAGCAGAAAATGTCTCCAGGG + Intronic
1014899504 6:126945520-126945542 CCTGGCAGATAAAGTTTCCAGGG - Intergenic
1015495019 6:133872101-133872123 TTGAGCAAACAAAGTTACCATGG - Intergenic
1017589172 6:155959971-155959993 CTGTCCAGAAACAGTTTCCATGG - Intergenic
1017814822 6:158009190-158009212 CGGAGCAGAAAAAGTGAGCAGGG - Intronic
1018540329 6:164872905-164872927 AGGAGCAGAAATAGTTTCCCAGG - Intergenic
1019488354 7:1299688-1299710 CTGAGCAGAAACAGCTTCTGGGG - Intergenic
1022258135 7:28679623-28679645 CTGACCAGGAAGATTTTCCAAGG - Intronic
1023242394 7:38162000-38162022 CTGAGTGGAAAAGGATTCCAGGG - Intergenic
1024057718 7:45674804-45674826 CAGAGCAAAAAAATTTACCAGGG - Intronic
1024173056 7:46810290-46810312 TTCAGCAGGAAAAGTCTCCAGGG - Intergenic
1024668154 7:51566055-51566077 CGGAGCAAAAATAGTTCCCATGG + Intergenic
1027222073 7:76220555-76220577 CTGGGCTGGCAAAGTTTCCAGGG - Intronic
1029000618 7:97150860-97150882 CTGATCAGAAAAAGATTCCTAGG - Intronic
1029571415 7:101372148-101372170 CTCCCCAGAAAAAGATTCCAAGG - Intronic
1030246340 7:107387782-107387804 CTGAGTGGAAAAAGTTTCCAAGG - Intronic
1034600343 7:152246726-152246748 TTGAGAAGAAAAACTTTTCATGG + Intronic
1035475615 7:159142206-159142228 CTTAGCAGTAACAGTTTCCATGG - Intronic
1036102294 8:5800618-5800640 CTGAGTGGAAAAGGTTTCCACGG + Intergenic
1036107281 8:5854648-5854670 CTGAAAAGAAAATGTTTCTAGGG + Intergenic
1036549276 8:9802584-9802606 CTGAGTGGAAAAGGTCTCCACGG - Intergenic
1036822821 8:11953815-11953837 CTGATGAGAAACAGTGTCCACGG + Intergenic
1036933034 8:12974518-12974540 CCCAACAGAATAAGTTTCCAGGG + Intronic
1040359836 8:46654607-46654629 CTGAGGGGAAAAAGTTTCCAAGG - Intergenic
1041210184 8:55542466-55542488 ATGAACAGAAAAAGTGTCAATGG + Intergenic
1041305514 8:56453922-56453944 CAGACCAGAAAAAGTTATCAGGG + Intergenic
1041456044 8:58061273-58061295 ATGAGCAGAAAACCCTTCCAGGG - Intronic
1041471826 8:58218566-58218588 CTGATCTGAAAAATTTGCCATGG + Intergenic
1042435586 8:68760948-68760970 CTGAGACGAAAAAGATTCCAAGG - Intronic
1043358220 8:79439097-79439119 CTGGGCAGAAAAATATGCCAAGG + Intergenic
1043608010 8:82026551-82026573 CAGAGAAGATTAAGTTTCCATGG - Intergenic
1043660493 8:82735240-82735262 CTGAGAGGAAAAAGTTTAAATGG - Intergenic
1047403723 8:124567753-124567775 CTGAGCACAGAACTTTTCCATGG - Intronic
1048182356 8:132207630-132207652 CTGAGTGAAAAAAGTCTCCAGGG - Intronic
1048621903 8:136142910-136142932 CTGAGGATATAAAGTTTCCCTGG + Intergenic
1048744371 8:137597600-137597622 CTAAGAAGAGAAACTTTCCAGGG + Intergenic
1048919180 8:139212237-139212259 CTGAGCTGAAAAAGTAGCCAAGG - Intergenic
1050925447 9:11257868-11257890 CTGAGTGGAAAATATTTCCAAGG + Intergenic
1051526942 9:18056019-18056041 ATGAGCAAAAACAGTTTCCTGGG + Intergenic
1052565692 9:30147420-30147442 CTGAACAGAGAGAGTTTCCTGGG + Intergenic
1053114858 9:35491174-35491196 CTGAGCAGATTTAGTTTCCTGGG + Intronic
1053237710 9:36470538-36470560 CTAAGCGGAATAAATTTCCATGG - Intronic
1055258768 9:74407001-74407023 CTGAGAAGAAACAGTCTCCAAGG - Intergenic
1058046823 9:100366069-100366091 CTGCGCAGAAAAAGTTTCCAAGG + Intergenic
1203585012 Un_KI270746v1:59202-59224 TTGAGAAGAAAAACTTTTCATGG + Intergenic
1187237463 X:17481371-17481393 CTCAGGAAACAAAGTTTCCATGG - Intronic
1188085553 X:25897707-25897729 CTGAGCGGAAAGGGTTTCTAGGG - Intergenic
1188256579 X:27968403-27968425 CTAAGCAGAAATGGATTCCAAGG + Intergenic
1188532745 X:31160707-31160729 CTGAGAAAAAAAGGATTCCAAGG - Intronic
1190184676 X:48223255-48223277 CTGGGGAGAAAATGTTTTCAAGG - Intronic
1190198801 X:48342931-48342953 CTGGGAAGAAAATGTTTTCAAGG + Intergenic
1190659402 X:52640995-52641017 CTGGGAAGAAAATGTTTTCAAGG + Intergenic
1190665568 X:52693338-52693360 CTGAGAAGAAAATGTTTTCAAGG + Intronic
1190673854 X:52765080-52765102 CTGAGAAGAAAATGTTTTCAAGG - Intronic
1190677329 X:52793393-52793415 CTGGGAAGAAAATGTTTTCAAGG - Intergenic
1191773050 X:64783354-64783376 CTGAGCAGAAAATGTTTTTAGGG + Intergenic
1192145451 X:68679392-68679414 CTGAGCATAAAAAGTTTAGATGG - Intronic
1192427747 X:71092399-71092421 CTAGTCAGGAAAAGTTTCCAAGG + Intergenic
1192717747 X:73661746-73661768 CTGAGCAGAAAAAGTTTCCAGGG + Intronic
1193159780 X:78215388-78215410 CTGAGCAGAAAAGTTTTCTAGGG + Intergenic
1194486638 X:94494312-94494334 CTGAGTGGAAAAAGTTTCCAAGG - Intergenic
1196216679 X:113060978-113061000 CTGATAAAAAAAAGTTTCCATGG + Intergenic
1196868566 X:120091231-120091253 GTGTGCAGAAAATATTTCCATGG + Intergenic
1197076034 X:122353803-122353825 CTGATAAGACAAAGTTTCAAAGG + Intergenic
1197628771 X:128833778-128833800 CAGAGCACAGAAAGTTTCAAGGG + Intergenic
1198428059 X:136539574-136539596 CTGAGAAGAAATAGTAACCAGGG - Intronic
1199572991 X:149286882-149286904 CTGATCAGAAATAATTTTCAGGG + Intergenic
1200205119 X:154310090-154310112 CACAGCAGAACACGTTTCCAAGG + Intronic
1200686061 Y:6260940-6260962 TTGAGAAGAAAATGTTTTCAGGG - Intergenic
1200824480 Y:7623710-7623732 CTGAGTGGAAAAAGTTTCTAAGG + Intergenic
1200975979 Y:9212562-9212584 CTGAGTGCAAAAAGTTTCCAAGG + Intergenic
1200994252 Y:9372463-9372485 TTGAGAAGAAAATGTTTTCAGGG - Intronic
1200999431 Y:9461355-9461377 TTGAGAAGAAAATGTTTTCAGGG - Intergenic
1201002086 Y:9481661-9481683 TTGAGAAGAAAATGTTTTCAGGG - Intronic
1201004751 Y:9501947-9501969 TTGAGAAGAAAATGTTTTCAGGG - Intergenic
1201007404 Y:9522273-9522295 TTGAGAAGAAAATGTTTTCAGGG - Intergenic
1201054766 Y:9977610-9977632 CTGAGTGGAAAAAGTTTCTAAGG - Intergenic
1201269999 Y:12245347-12245369 GTGAGAAGAAAAAGATCCCAGGG + Intergenic
1201520848 Y:14871983-14872005 CTGAGCAGAAAATGCTTCTAAGG + Intergenic
1202038837 Y:20662139-20662161 CTGAGTGGAAAAGATTTCCAGGG - Intergenic
1202069046 Y:20971394-20971416 CTGAGTGAAAAAAGTTTCCAAGG - Intergenic
1202081716 Y:21090574-21090596 CTGAGCAGAAAAAGTCTCCAAGG + Intergenic
1202135185 Y:21653973-21653995 CTGAGTGCAAAAAGTTTCCAAGG - Intergenic
1202235575 Y:22707377-22707399 CTGAGTGGAAAAAGTTTCTAAGG - Intergenic
1202307584 Y:23488791-23488813 CTGAGTGGAAAAAGTTTCTAAGG + Intergenic
1202563217 Y:26181795-26181817 CTGAGTGGAAAAAGTTTCTAAGG - Intergenic