ID: 1192722328

View in Genome Browser
Species Human (GRCh38)
Location X:73712114-73712136
Sequence CCGAAGAGATGGAGAGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192722323_1192722328 11 Left 1192722323 X:73712080-73712102 CCTGAGAGGACTTACCAATGACC No data
Right 1192722328 X:73712114-73712136 CCGAAGAGATGGAGAGCATAAGG No data
1192722325_1192722328 -10 Left 1192722325 X:73712101-73712123 CCATATCAGCAATCCGAAGAGAT No data
Right 1192722328 X:73712114-73712136 CCGAAGAGATGGAGAGCATAAGG No data
1192722324_1192722328 -3 Left 1192722324 X:73712094-73712116 CCAATGACCATATCAGCAATCCG No data
Right 1192722328 X:73712114-73712136 CCGAAGAGATGGAGAGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192722328 Original CRISPR CCGAAGAGATGGAGAGCATA AGG Intergenic
No off target data available for this crispr