ID: 1192727777

View in Genome Browser
Species Human (GRCh38)
Location X:73769933-73769955
Sequence GTTGGCCAGCTCTACATCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192727777_1192727782 -1 Left 1192727777 X:73769933-73769955 CCGAAGATGTAGAGCTGGCCAAC 0: 1
1: 0
2: 0
3: 18
4: 140
Right 1192727782 X:73769955-73769977 CCAGGAGGCGATGATGAACATGG No data
1192727777_1192727785 24 Left 1192727777 X:73769933-73769955 CCGAAGATGTAGAGCTGGCCAAC 0: 1
1: 0
2: 0
3: 18
4: 140
Right 1192727785 X:73769980-73770002 AGGCTCAACAGGACAGCTGCAGG 0: 1
1: 2
2: 3
3: 17
4: 189
1192727777_1192727783 4 Left 1192727777 X:73769933-73769955 CCGAAGATGTAGAGCTGGCCAAC 0: 1
1: 0
2: 0
3: 18
4: 140
Right 1192727783 X:73769960-73769982 AGGCGATGATGAACATGGTGAGG 0: 1
1: 1
2: 3
3: 10
4: 179
1192727777_1192727784 13 Left 1192727777 X:73769933-73769955 CCGAAGATGTAGAGCTGGCCAAC 0: 1
1: 0
2: 0
3: 18
4: 140
Right 1192727784 X:73769969-73769991 TGAACATGGTGAGGCTCAACAGG 0: 1
1: 2
2: 6
3: 5
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192727777 Original CRISPR GTTGGCCAGCTCTACATCTT CGG (reversed) Intergenic
901110255 1:6787546-6787568 GATGACTAGCTCTACATTTTGGG + Intronic
901410589 1:9080613-9080635 GTTGGCCGTCTGTACATCTTTGG + Intronic
903500246 1:23796573-23796595 GTGGGCCAGATCTACAACCTGGG - Exonic
904405895 1:30287684-30287706 GGTGGCCCGCTCCACATTTTGGG - Intergenic
908960961 1:69696162-69696184 GTTGGGCAACTCTACCTCTGTGG - Intronic
910303019 1:85728529-85728551 ATTGGCCATTTCTATATCTTTGG + Intergenic
910780293 1:90924996-90925018 GTTGGCCAGAGCTAAATTTTAGG - Intronic
911133136 1:94411336-94411358 GTTGGCCATTTGTATATCTTTGG - Intergenic
911939287 1:104020827-104020849 CTTGGGCAGCTCTACCTCTGTGG + Intergenic
913450917 1:118992073-118992095 GTTGGCCAGCCGGACATATTAGG + Intergenic
915361096 1:155286829-155286851 GTTGCCCAGGTCTACCTCTTGGG + Intronic
918561719 1:185876691-185876713 GTTGGCCATTTGTATATCTTTGG + Intronic
1063317025 10:5016532-5016554 CTTGGGCAGCTCTACCTCTGTGG + Intronic
1065226132 10:23545474-23545496 CTTGGGCAGCTCTGCATCTATGG - Intergenic
1066695814 10:38076715-38076737 GTTGGGCAGCTCTGCCTCTGTGG + Intergenic
1068261794 10:54592988-54593010 GTTTGCCATTTGTACATCTTTGG + Intronic
1069059293 10:63877470-63877492 GTTGGCCATTTGTATATCTTTGG + Intergenic
1069803419 10:71099121-71099143 GTTGGCCATTTATATATCTTTGG - Intergenic
1070023400 10:72608452-72608474 ATTGGCCATTTGTACATCTTTGG - Intronic
1074551619 10:114448545-114448567 GTTGGCGGGCTTTGCATCTTTGG + Intronic
1075361804 10:121844308-121844330 GTTTGCCATTTGTACATCTTGGG - Intronic
1076255989 10:129025363-129025385 GCTGGCCAGCTCTACTTTCTAGG - Intergenic
1077031148 11:468407-468429 GTTGTCCAGTTCTACAGGTTCGG - Intronic
1082213146 11:49530973-49530995 ATTGGCCATTTCTACATCTTTGG + Intergenic
1082718315 11:56642108-56642130 GCTGCCCAGTTCTACTTCTTTGG - Exonic
1085508125 11:77071698-77071720 GTTGCCCAGCCTGACATCTTGGG + Intronic
1086580302 11:88391537-88391559 CTTGGGCAGCTCTACCTCTGTGG + Intergenic
1086636453 11:89093544-89093566 ATTGGCCATTTCTACATCTTTGG - Intergenic
1087729989 11:101767929-101767951 CTTGGGCAGCTCTACCTCTATGG + Intronic
1087786008 11:102354871-102354893 GTTGGCCATTTGTATATCTTTGG + Intronic
1087922121 11:103878267-103878289 TGTGGCCAGCTCTACAGGTTAGG + Intergenic
1090624017 11:128589750-128589772 ATTGGCCATTTCTGCATCTTTGG - Intergenic
1090707009 11:129347044-129347066 ATTGGCCAGTTGTATATCTTTGG - Intergenic
1092326335 12:7534986-7535008 CTTGGGCAGCTCTGCTTCTTTGG - Intergenic
1093348104 12:18064996-18065018 GCAGACCAGCTCTACATGTTTGG + Intergenic
1097558100 12:61166130-61166152 CTTGGGCAGCTCCACCTCTTTGG + Intergenic
1098774937 12:74600656-74600678 CTTGGGCAGCTCTACCTCTGTGG - Intergenic
1099492852 12:83307590-83307612 CTTGGGCAGCTCCACCTCTTTGG - Intergenic
1099722607 12:86383153-86383175 CTTGGGCAGCTCTACCTCTATGG - Intronic
1100541640 12:95562789-95562811 GTTAGCCAGTTCTACAACTGTGG - Intergenic
1101131881 12:101698127-101698149 ATCGGCCAGCCCTACCTCTTCGG - Exonic
1102456171 12:113072005-113072027 GTTGGCCAGCTCTGCAGCAAAGG - Intronic
1104320916 12:127749914-127749936 CTTGGCCATCTCTATAACTTTGG + Intergenic
1105263491 13:18797000-18797022 CTTGGGCAGCTCTGCATCTGTGG + Intergenic
1107202385 13:37737390-37737412 GTTGTCCAACACTACATCCTTGG + Intronic
1108979125 13:56488134-56488156 GTTGCCCAGTTCTTCATCTTTGG - Intergenic
1109107883 13:58277894-58277916 CTTGGTCAGCTCTACACCTGTGG + Intergenic
1109324604 13:60852543-60852565 CTTGGGCAGCTCTGCATCTGTGG + Intergenic
1110877679 13:80530000-80530022 GTTGGACATTTGTACATCTTTGG + Intergenic
1113501814 13:110781849-110781871 TTTGGGCAGCTCCACATCTGTGG + Intergenic
1114991922 14:28298365-28298387 CTTGGCCAGCTCTGCCTCTGTGG - Intergenic
1115373924 14:32652043-32652065 GGTGTCCGGATCTACATCTTCGG + Intronic
1115416165 14:33136593-33136615 GTTGACTAGCTATACAACTTGGG - Intronic
1116339748 14:43706478-43706500 GTTAGCCAACTCTACATCTGAGG - Intergenic
1118897895 14:69962034-69962056 TTTGGCCATTTCTATATCTTTGG + Intronic
1120485833 14:85112483-85112505 CTTGGCCAGCTCTGCCTCTGTGG + Intergenic
1120711798 14:87800141-87800163 GCTGGCCAGCTTTACCTTTTAGG + Intergenic
1120883397 14:89432724-89432746 GCTGGTCATCTCTACCTCTTAGG + Intronic
1202835357 14_GL000009v2_random:74122-74144 CTTGGGCAGCTCTACACCTGTGG - Intergenic
1202918247 14_KI270723v1_random:4880-4902 GTTGGCCATTTGTATATCTTTGG - Intergenic
1124043080 15:26122927-26122949 ATTGGCCAACTGTATATCTTTGG + Intergenic
1127051080 15:55084912-55084934 CTTGGGCAGCTCTACCTCTGTGG - Intergenic
1127163052 15:56211738-56211760 ATTTGCCATCTGTACATCTTCGG - Intronic
1131980555 15:97990716-97990738 GTTAGACACCTCTACATGTTTGG - Intergenic
1132983360 16:2750752-2750774 GTTGGCCGTTTGTACATCTTTGG - Intergenic
1136642435 16:31578116-31578138 CTTGGGCAGCTCTACCCCTTTGG - Intergenic
1137363980 16:47844684-47844706 ATTGGCCATCTGTAAATCTTTGG - Intergenic
1139233284 16:65307978-65308000 TTTGACCAGCTGTACAACTTGGG + Intergenic
1139407519 16:66730807-66730829 GCTGGCCAGCTCAACATCACAGG + Intronic
1139431511 16:66913358-66913380 GTGGGCCAGCTCCAGCTCTTCGG + Intronic
1143835908 17:9692473-9692495 CTTGGCCATCTGTACATCTTTGG + Intronic
1145022634 17:19443581-19443603 CTTGGGCAGCTCTACCTCTGTGG - Intergenic
1150112627 17:62515610-62515632 GTTGGCCATTTTTATATCTTTGG + Intronic
1151527672 17:74682018-74682040 GTTAGCCAGCTGTACATTCTAGG + Intronic
1153463966 18:5368174-5368196 GTTGGCCAGGACTTCATCATAGG + Intergenic
1154472567 18:14719392-14719414 ATTGGCCATTTCTATATCTTTGG + Intergenic
1159215629 18:65387327-65387349 GTTGGGCAGCTCCACCCCTTTGG - Intergenic
1159805791 18:72957206-72957228 CTTGGGCAGCTCTACCTCTGTGG + Intergenic
1161879384 19:6937262-6937284 TTTGCCCAGCTCTTCATCCTGGG + Exonic
1162195429 19:8980928-8980950 CTTGGCCAGTCCTACATCTTCGG - Exonic
1162528744 19:11223089-11223111 CTCGGCCAGCTCCACATCCTGGG + Exonic
1163448448 19:17361404-17361426 GTAGGCCAGCTCTGCAGCATGGG - Intronic
1167214827 19:48157480-48157502 GTTGGCCAGCTCTACACAATGGG + Intronic
924966005 2:77099-77121 CTTGGGCAGCTCTACCTCTGTGG + Intergenic
925862871 2:8197417-8197439 GGTGGCCACCACTACATCTTTGG - Intergenic
926840219 2:17071522-17071544 CTTGGGCAGCTCTACTTCTGTGG - Intergenic
928076511 2:28269921-28269943 CTTGGCCAACTATACATATTAGG + Intronic
932793783 2:74678047-74678069 CTTGGCCAGCTTTGCATTTTTGG + Intronic
935076047 2:99745157-99745179 GTTGGCCATTTGTACATCTTTGG + Intronic
937762978 2:125627884-125627906 GTTGGGCAGCTCTACCCCTGTGG - Intergenic
939047415 2:137266257-137266279 GTTGGCCTGTTTTACAACTTAGG + Intronic
941741952 2:169044576-169044598 GTTGGGCAGCTCTACTCCTATGG - Intergenic
946989464 2:225311999-225312021 GTTGGCACTCTCTACATCTTTGG - Intergenic
1168816093 20:738141-738163 ATTGGCCACTTGTACATCTTTGG - Intergenic
1170995423 20:21351378-21351400 TTTGGCCATTTCTAAATCTTTGG + Intronic
1171474345 20:25396507-25396529 CTTGGCCTTCTCTCCATCTTTGG + Intergenic
1174091904 20:48055913-48055935 CTTGGCCAGTTCTCCATCTTAGG + Intergenic
1176366243 21:6034498-6034520 GCTGGCCCGCTCTGCACCTTGGG - Intergenic
1176801923 21:13438501-13438523 ATTGGCCATTTCTATATCTTTGG - Intergenic
1179757274 21:43504047-43504069 GCTGGCCCGCTCTGCACCTTGGG + Intergenic
1183025005 22:35058403-35058425 CTTGGCCTGCTCTAGATTTTGGG - Intergenic
950213128 3:11138408-11138430 GCTGGCCATCTGTATATCTTTGG - Intronic
952939653 3:38432784-38432806 TTTGGCCAGCTCCACCTCTGTGG + Intergenic
953544440 3:43853977-43853999 CCTGGCCAGCTCTATATCTCTGG + Intergenic
955278036 3:57566733-57566755 GTTGGCCATCTATATATCTCTGG + Exonic
958735350 3:98002920-98002942 GTTGGCCAGGTGTATTTCTTAGG - Intronic
964994724 3:162864149-162864171 GTTGCTCATCTCTAAATCTTGGG - Intergenic
965604939 3:170488901-170488923 GTTGGCTATCTCTATATCTTAGG + Intronic
969162872 4:5276778-5276800 GTTGGCCAGCTGTGCCTCTCTGG - Intronic
969725800 4:8917428-8917450 GTCAGCGAGCTGTACATCTTAGG - Intergenic
970360904 4:15308069-15308091 GTTGGGCAGCTCCACCTCTGTGG + Intergenic
971845832 4:31916704-31916726 CTTGGGCAGCTCTACTCCTTTGG - Intergenic
973314003 4:48740629-48740651 GTTTGCCATCTGTATATCTTTGG - Intronic
973803569 4:54501985-54502007 GTTAGACAACTCTACAACTTTGG - Intergenic
974569691 4:63628472-63628494 CTTGGGCAGCTCTGCCTCTTTGG - Intergenic
980598579 4:134988596-134988618 TTTTGGCAGCTCTACTTCTTTGG - Intergenic
980895936 4:138860432-138860454 GTGGGCAAGCTCTACCTTTTAGG - Intergenic
981882829 4:149636232-149636254 GGTGGCCATCTCTTCCTCTTTGG - Intergenic
982832888 4:160086084-160086106 CTTGGGCAGCTCTACCCCTTTGG + Intergenic
982849418 4:160293897-160293919 TTTTTCAAGCTCTACATCTTTGG + Intergenic
983462311 4:168042496-168042518 GTTGGCCATTTGTACATTTTTGG - Intergenic
990495507 5:56343773-56343795 CTTGGCTAGCTCTACAACTTTGG + Intergenic
997294731 5:132762323-132762345 GCTGGCCAGTCCTACATCTGTGG - Intronic
998355090 5:141528674-141528696 GTTGTCCTGCCCTACCTCTTTGG + Intronic
1000305487 5:159990779-159990801 ATTTGCCCGCTGTACATCTTTGG + Intergenic
1001142961 5:169160773-169160795 GTTGGCCTGTTTGACATCTTTGG - Intronic
1004779737 6:18895288-18895310 GCTGGCCAACTCTAATTCTTTGG + Intergenic
1009554708 6:65148478-65148500 CTTGGGCAGCTCTACTTCTGTGG + Intronic
1010649163 6:78430756-78430778 ATTTGCCATCTGTACATCTTTGG + Intergenic
1011327569 6:86166763-86166785 GTTGGCCATTTGTATATCTTTGG - Intergenic
1011504601 6:88028075-88028097 CTTGGGCAGCTCTACCTCTTTGG + Intergenic
1012715614 6:102665383-102665405 ATTGTCCTGCTCTAGATCTTAGG - Intergenic
1013937589 6:115616816-115616838 GTTGGCAATCTCCACTTCTTTGG - Intergenic
1014031247 6:116707457-116707479 GTTGGCCAGCTTTATCTCTCAGG + Intronic
1015502622 6:133950204-133950226 CTAGGCCAGTTCTACATTTTAGG + Intergenic
1015770986 6:136768407-136768429 GTTGGCCATTTGTATATCTTTGG - Intronic
1016774005 6:147884188-147884210 CTTTGCCAACTGTACATCTTAGG - Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1024538137 7:50455205-50455227 GCTGGCCAGTTCTTCCTCTTAGG + Intronic
1027008272 7:74717435-74717457 GTTTACCAGCTCTACAGCTTTGG + Intronic
1029003236 7:97178640-97178662 CTTGGCCATCTGTATATCTTTGG + Intronic
1033333955 7:140436601-140436623 ATTAGCCAGCACTTCATCTTTGG + Intergenic
1035725246 8:1820626-1820648 GTTGGCTATCAGTACATCTTTGG + Intergenic
1038004032 8:23415102-23415124 GTTTGCCATCTGTACATCTTTGG + Intronic
1044863063 8:96542128-96542150 GTGGGGCAGCACTACATATTGGG - Intronic
1045048873 8:98304924-98304946 GTTTGCCAACTATAGATCTTGGG - Intergenic
1047606171 8:126476912-126476934 GTTTGCCAGCTCCCCACCTTTGG - Intergenic
1049825646 8:144666015-144666037 GTTGGACAGCTCCACCTCTGTGG - Intergenic
1056297347 9:85206097-85206119 GCTGGCCAGCTCTCCTTCTCAGG - Intergenic
1058309785 9:103485827-103485849 CTTGGGCAGCTCTACACCTGTGG - Intergenic
1059328477 9:113519469-113519491 GATGCCCAGATCTACATGTTTGG - Intronic
1191084000 X:56545338-56545360 CTTGGGCAGCTCCACATCTGTGG + Intergenic
1192432371 X:71121085-71121107 GATTGCCACCTCTACATCATGGG - Exonic
1192727777 X:73769933-73769955 GTTGGCCAGCTCTACATCTTCGG - Intergenic
1192967546 X:76195301-76195323 CTTGGGCAGCTCTACTTCTGTGG + Intergenic
1196750473 X:119112532-119112554 GTTGGCCATTTATATATCTTTGG - Intronic
1196861290 X:120030024-120030046 GTTGGCCATCTGTATGTCTTTGG + Intergenic
1199451616 X:147983514-147983536 GTTGGCCATTCGTACATCTTTGG + Intronic
1199750331 X:150810070-150810092 ATTGGTCAGTTGTACATCTTTGG - Intronic