ID: 1192733636

View in Genome Browser
Species Human (GRCh38)
Location X:73826978-73827000
Sequence TTGGCTCTTGAGGCTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 381}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192733626_1192733636 24 Left 1192733626 X:73826931-73826953 CCATCCAACTCAGGCCTTCGGTC 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1192733636 X:73826978-73827000 TTGGCTCTTGAGGCTTTTGTTGG 0: 1
1: 0
2: 0
3: 37
4: 381
1192733630_1192733636 2 Left 1192733630 X:73826953-73826975 CCAATTCAGGCCACCCTCTGTTT 0: 1
1: 0
2: 1
3: 13
4: 179
Right 1192733636 X:73826978-73827000 TTGGCTCTTGAGGCTTTTGTTGG 0: 1
1: 0
2: 0
3: 37
4: 381
1192733627_1192733636 20 Left 1192733627 X:73826935-73826957 CCAACTCAGGCCTTCGGTCCAAT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1192733636 X:73826978-73827000 TTGGCTCTTGAGGCTTTTGTTGG 0: 1
1: 0
2: 0
3: 37
4: 381
1192733632_1192733636 -8 Left 1192733632 X:73826963-73826985 CCACCCTCTGTTTTCTTGGCTCT 0: 1
1: 0
2: 2
3: 58
4: 535
Right 1192733636 X:73826978-73827000 TTGGCTCTTGAGGCTTTTGTTGG 0: 1
1: 0
2: 0
3: 37
4: 381
1192733629_1192733636 10 Left 1192733629 X:73826945-73826967 CCTTCGGTCCAATTCAGGCCACC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1192733636 X:73826978-73827000 TTGGCTCTTGAGGCTTTTGTTGG 0: 1
1: 0
2: 0
3: 37
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192733636 Original CRISPR TTGGCTCTTGAGGCTTTTGT TGG Intergenic
900267076 1:1763031-1763053 TTGGGACTTGAGGATTTTGTTGG - Intronic
900851980 1:5151094-5151116 CTGTCTCTTGTGGCTCTTGTAGG - Intergenic
903048333 1:20581773-20581795 TTGCCTCTGGAGGAGTTTGTTGG - Intergenic
904016969 1:27429230-27429252 TTGCCTCTGGAGACTCTTGTTGG - Intronic
905217299 1:36417851-36417873 ATGGCTCAGGAGGCTTTTGGTGG + Intronic
906081977 1:43097556-43097578 TTAGCTATTCAGGCTTTTATGGG - Intergenic
906447319 1:45913633-45913655 TGGGCTCTTAGGTCTTTTGTGGG + Intronic
907362258 1:53927524-53927546 TTGTCTCTTGAGGGTTGTGGTGG + Intronic
907429246 1:54402389-54402411 TTGGCACTTGAACCTTTTTTAGG - Intronic
908864763 1:68534883-68534905 TTGGCTATTCAGGATTTTTTTGG - Intergenic
909430727 1:75584553-75584575 TTTGCTTTTGGGGGTTTTGTGGG + Intronic
910128922 1:83879938-83879960 ATGGATCTTGTAGCTTTTGTGGG - Intronic
912198375 1:107426645-107426667 TTGGCTATTTGGGCTTTTTTTGG + Intronic
912590892 1:110818901-110818923 TTGGCTATTGGGGCTATTTTGGG + Intergenic
913036572 1:114971458-114971480 TTGGCTCTGTTGGCTGTTGTGGG - Intronic
913135230 1:115882025-115882047 ATGGCTTTAGAGGCTGTTGTAGG + Intergenic
915625118 1:157109660-157109682 TTGCCTCTATAGGCTTTTCTAGG + Intergenic
916706945 1:167360663-167360685 TTGGCTATTCAGGCTCTTTTTGG + Intronic
916829781 1:168479021-168479043 TTGGCTGTTCAGGCATTTTTTGG - Intergenic
916881309 1:169021979-169022001 CTGGCTCTTGGGACTTTTGATGG - Intergenic
916883568 1:169045924-169045946 TTAGCTCTTGTGGGTTTTGTAGG + Intergenic
917377304 1:174363254-174363276 TTGGCTATTCAAGCTTTTCTGGG + Intronic
917623332 1:176820333-176820355 GAGGCTCTTGTGGCTTTTCTCGG + Intronic
918536369 1:185579292-185579314 TTGGCTATTCAGGCTTTTTTTGG + Intergenic
918876847 1:190057952-190057974 TGGGGTCTTTAGGCTTTTCTAGG + Intergenic
919295640 1:195696503-195696525 TTATCTCTGGAGGCTTTTGGGGG - Intergenic
919539158 1:198827707-198827729 TAGGGTCTTGAGGCTTTTATAGG + Intergenic
920092099 1:203462150-203462172 TTTGCTCCTGCTGCTTTTGTGGG + Intergenic
920808630 1:209259712-209259734 CTAGCTCTTAAGGCTTTTGTGGG + Intergenic
922313365 1:224417707-224417729 TTTGTTCTTGATGTTTTTGTTGG - Intronic
923049482 1:230380806-230380828 TTGACTGTTGAGCCTTTTGGTGG - Intronic
924617927 1:245629720-245629742 TTGTCAATTGTGGCTTTTGTTGG - Intronic
1063058542 10:2527157-2527179 TTCCCTCTTAAGGTTTTTGTTGG - Intergenic
1064105250 10:12495727-12495749 TTGTCTGTTGAGGATTTAGTGGG + Intronic
1064740380 10:18427365-18427387 TTGACTCTTGAAGATTTTGGGGG + Intronic
1068271288 10:54729089-54729111 TTGGCTATTCAGGCTCTTTTTGG - Intronic
1068925732 10:62535802-62535824 TTGGCTATTCAGGCTCTTTTTGG - Intronic
1069621599 10:69840815-69840837 TGGTCTCTTGAGGCTTCTGCTGG + Intronic
1070375092 10:75822481-75822503 TTGGCTATTCAGGCTTTTTTTGG - Intronic
1070671073 10:78377576-78377598 TTGGCTATGGAGGGCTTTGTAGG + Intergenic
1070976725 10:80611254-80611276 TTGGCTCCTAAAGCTTTTGCAGG + Intronic
1072019029 10:91380291-91380313 TTAGATCTTGGGGCTTTTGCAGG - Intergenic
1072203896 10:93185421-93185443 TTGGCTATTCAGGCTTTTTTTGG + Intergenic
1073171499 10:101512954-101512976 TTGAGTCATCAGGCTTTTGTTGG + Intronic
1073518435 10:104101173-104101195 TTGGCTTATGAGGATTTTTTAGG + Intergenic
1074096473 10:110317952-110317974 TAGGATCTTCAGGTTTTTGTGGG - Intergenic
1074466760 10:113690655-113690677 TTGGCTCTGGGTGCTTTTGGCGG + Intronic
1074988596 10:118681071-118681093 TTGGCTCTTGATCTTTTGGTGGG - Exonic
1075308240 10:121387711-121387733 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1075502780 10:122992266-122992288 TTGGCACTTGGGGGTTTTGTGGG + Exonic
1078701470 11:13688426-13688448 TTAGCTGTTTAGGCTTTGGTAGG + Intronic
1079742682 11:24083211-24083233 TGAGCTCTTCAGGCTTCTGTAGG - Intergenic
1079744258 11:24105710-24105732 TTGGCTATTGGGGCTCTTTTTGG - Intergenic
1080097574 11:28427405-28427427 TTGGCTCTCTGGGCTTTTTTTGG + Intergenic
1080865688 11:36192822-36192844 TTGGCCCCTGAGGCTTTGGCTGG - Intronic
1080978120 11:37366093-37366115 TTGGCTCTTGATGCTTTAAGGGG - Intergenic
1081073298 11:38636736-38636758 TTGGCTATTGTGGCTTTTTGTGG + Intergenic
1081463561 11:43295067-43295089 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1082612347 11:55316442-55316464 GTGACTCTGGAGGCTTTTGGAGG - Intergenic
1083004579 11:59330835-59330857 TTTGATCATGAGGCTTTTTTAGG - Intergenic
1084611473 11:70205873-70205895 TTGGCACTTGAGTCTTCAGTGGG + Intronic
1085496538 11:76975146-76975168 TTGGCTTTTGTGTCTTTTGTTGG + Intronic
1086045863 11:82530810-82530832 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1086228578 11:84541597-84541619 TCTGCTCTTGAGGCATTTGTGGG - Intronic
1088356577 11:108950369-108950391 TTGGCTATACAGGCTTTTTTTGG + Intergenic
1088603425 11:111505136-111505158 TTGGCTATTTGGGCTTTTTTTGG - Intronic
1088898086 11:114092869-114092891 CTGGCTCTTGAGGGTTCTTTGGG + Intronic
1089122080 11:116144594-116144616 TAGGGTCTTGGGGTTTTTGTAGG - Intergenic
1090143398 11:124291071-124291093 TTGGCTATTCAGGCTGTTATTGG + Intergenic
1090466926 11:126943194-126943216 TTGGCTTTTGAGGTGTTTCTGGG + Intronic
1090815465 11:130290245-130290267 TTGCCTCTTGCAGCTTATGTGGG - Intronic
1092398339 12:8148389-8148411 TTGTCTCTTTTGACTTTTGTTGG - Intronic
1092700354 12:11222203-11222225 TTGGCTATGCAGGCTTTTTTTGG - Intergenic
1092952434 12:13519350-13519372 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1092990494 12:13892738-13892760 TTAGCTCTTGGGACTTTTGTTGG - Intronic
1093689740 12:22097036-22097058 TTGGCTATTCAGGCTTATTTTGG + Intronic
1095989381 12:48023998-48024020 TTGGGTCTGGAGCCTTTTGTAGG - Intronic
1096867990 12:54576536-54576558 TTACCTCTTGCGGCTTTTGGGGG + Intronic
1097749707 12:63338206-63338228 TTGGCTATTGAAGCTTGTGCAGG - Intergenic
1097782327 12:63722598-63722620 TTAGCGCTTCAGGCCTTTGTAGG + Intergenic
1097952380 12:65446077-65446099 TTGCTTCTTGAGACTATTGTTGG + Intronic
1098165443 12:67692748-67692770 TTGCCTTTTGAGGCTTAAGTTGG - Intergenic
1099845462 12:88023025-88023047 TTGGCTCTTTAGGCTCCTTTTGG - Intronic
1100068341 12:90679465-90679487 TTGCCTATTTAGGATTTTGTTGG + Intergenic
1100099597 12:91087295-91087317 TTGGCTATTTAGGCATTTTTTGG + Intergenic
1100206638 12:92356911-92356933 TTGGCTCTTGAGGAACATGTAGG - Intergenic
1100749520 12:97681723-97681745 TTGGTTCATGAGGTTTGTGTCGG - Intergenic
1106648193 13:31659772-31659794 TTGGCTATTTGGGCTTTTTTGGG + Intergenic
1107359576 13:39603543-39603565 TTGCCTGTTGGGGCTTTTCTGGG + Intergenic
1109003508 13:56836802-56836824 TTGGCTATTCAGGCTTATTTTGG - Intergenic
1109308713 13:60667190-60667212 TTGGCTATTTAGGCTTTTTTTGG + Intergenic
1110396569 13:75036534-75036556 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1110788860 13:79565164-79565186 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
1111338447 13:86852111-86852133 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1111491961 13:88990646-88990668 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
1112147782 13:96720467-96720489 TTTGCTTTTGAGGCTTATGGGGG + Intronic
1112782843 13:102920534-102920556 TTGGCTGATGAGGCTTCTTTTGG - Intergenic
1112941358 13:104866297-104866319 TAGGTTCTTGAGGTTTTTATAGG - Intergenic
1115538490 14:34396171-34396193 TTGGCTATACAGGCTTTTTTTGG - Intronic
1115797947 14:36960057-36960079 TTTGCACTGTAGGCTTTTGTGGG - Intronic
1115832870 14:37361877-37361899 TTGTCTCTTTTGACTTTTGTTGG + Intronic
1115947682 14:38681006-38681028 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1116045443 14:39737244-39737266 TTGTCTCTTCTGGCTTTTGGTGG + Intergenic
1116066213 14:39986349-39986371 TTGGCTCCTGAGAAATTTGTAGG + Intergenic
1116102911 14:40464804-40464826 TGGGCTCTTGAGGCTGCTTTGGG - Intergenic
1116108092 14:40537647-40537669 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1116197147 14:41742681-41742703 CTGGCTCTTCTGGCTCTTGTTGG - Intronic
1116318303 14:43426532-43426554 TTGGCTATACAGGCTTTTTTTGG - Intergenic
1116593810 14:46814099-46814121 TTGGCTATTCAGGCTTTTTCTGG - Intergenic
1116796632 14:49398103-49398125 TTGGCTATTTAGGCTCTTTTTGG - Intergenic
1117502695 14:56369491-56369513 TTGGCTATTCAGGCTTTTCTTGG + Intergenic
1117824993 14:59692581-59692603 TTGGCTCTTCAGGCTCTTTTTGG - Intronic
1117917935 14:60697947-60697969 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1118034555 14:61852390-61852412 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1118730825 14:68665138-68665160 ATGACTTTTAAGGCTTTTGTTGG + Intronic
1119124789 14:72115628-72115650 GGGGCTGTTGAGGCTTTTGTGGG - Intronic
1120876616 14:89381512-89381534 TTGCTTTTTGAGGCTTTTTTTGG - Intronic
1121260441 14:92562047-92562069 TTGTCTCCTTAGGCTTTTCTTGG + Intronic
1122368245 14:101211348-101211370 TTGGCTTGTGATGTTTTTGTCGG + Intergenic
1202830949 14_GL000009v2_random:29507-29529 CTGGTTCTTGAGACTTTTTTGGG - Intergenic
1126542691 15:49840123-49840145 ATGGCTCCTGAGGCTCTTGTCGG - Intergenic
1126779302 15:52125022-52125044 TTGGCTCTTGAGGGTTGAATCGG + Intronic
1127145475 15:56018803-56018825 TAGGGGCTTGAGGCTTCTGTGGG - Intergenic
1129560081 15:76557278-76557300 TTGGCTATTGGGGCTCTTTTTGG - Intronic
1130248439 15:82276376-82276398 TTGGCTATTCAGGCTCTTTTTGG - Intronic
1130451902 15:84063409-84063431 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1130730077 15:86482822-86482844 TTGGCTGATGAAGCTTTTGTTGG - Intronic
1131660470 15:94509923-94509945 TTGGCTATTCAGGGTCTTGTTGG - Intergenic
1133093239 16:3421875-3421897 TTGGCTATTCAGGCTCTTTTTGG + Intronic
1133915240 16:10103528-10103550 ATGGCTCTTGAGTGTTTTGGGGG + Intronic
1134214124 16:12302882-12302904 TTGGCTCTTGAGGAGCTTCTGGG + Intronic
1136695257 16:32074563-32074585 TTGGCTATTCAGGCTGTTTTTGG - Intergenic
1136795756 16:33017820-33017842 TTGGCTATTCAGGCTGTTTTTGG - Intergenic
1136874162 16:33836560-33836582 TTGGCTATTCAGGCTGTTTTTGG + Intergenic
1137246424 16:46709597-46709619 TTGGATCTTGAAGCTTTGGCAGG + Exonic
1137307252 16:47214705-47214727 TTGGCTATTCAGGCTTTGCTAGG + Intronic
1141195230 16:81855738-81855760 TTGGGTTTTGAGGCTTCAGTAGG + Intronic
1141695539 16:85617384-85617406 GCTGCACTTGAGGCTTTTGTGGG + Intronic
1142243574 16:88958304-88958326 TGGGCTCTTGAAGCTATTTTAGG - Intronic
1203098014 16_KI270728v1_random:1279479-1279501 TTGGCTATTCAGGCTGTTTTTGG - Intergenic
1143986063 17:10915485-10915507 TTGGGCCTTGAGGCTGATGTGGG + Intergenic
1144394245 17:14828106-14828128 GTGGCTCCTGAGGATTTTCTGGG + Intergenic
1147882670 17:43664110-43664132 TTGCCTCAGAAGGCTTTTGTGGG - Intergenic
1148131989 17:45267559-45267581 TTGGCTCTGGGGGCTCTGGTGGG + Exonic
1149393059 17:56211577-56211599 TTGGCTATGCAGGCTTTTTTTGG + Intronic
1150559860 17:66285149-66285171 TTGTTCCTTGAGGCTTTTTTTGG + Intergenic
1151162458 17:72176787-72176809 CTAACTGTTGAGGCTTTTGTTGG - Intergenic
1151478294 17:74355810-74355832 TTGGGTCTTGATGGTTGTGTTGG + Exonic
1152397339 17:80041771-80041793 TAGGGTCATGAGGCTTTAGTGGG + Intronic
1152913636 17:83020502-83020524 TTGGTCCTTGTGGCCTTTGTGGG - Intronic
1153133050 18:1879691-1879713 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1154761662 18:18578230-18578252 CTAGCTCTTGAGGATTTCGTTGG + Intergenic
1156524680 18:37755758-37755780 TTGGCTCTTGCTTCTTTTGGAGG + Intergenic
1157125495 18:44952126-44952148 TGGCTTCTTGAGGCTTTCGTGGG - Exonic
1160917322 19:1503482-1503504 CTGGCTCATGAGGCTACTGTCGG - Intergenic
1163698711 19:18776637-18776659 TGGGCTCTTGAGGCCATTGCGGG - Intronic
1165176242 19:33932019-33932041 TTTTCTCTTGAGTCTTTTTTTGG + Intergenic
925606828 2:5668353-5668375 TCAGCTCTTGAGGGTTCTGTGGG - Intergenic
925790668 2:7483470-7483492 TTGTCTATTCAGGCTTTTTTTGG - Intergenic
926553831 2:14333146-14333168 ATAGCTCTTGAGGATTTTATTGG + Intergenic
926764022 2:16306724-16306746 TTGGGTCTTGAGTCTTGGGTGGG + Intergenic
927081143 2:19631884-19631906 TTGGCTCTTAAAACTTGTGTGGG + Intergenic
927127887 2:20029855-20029877 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
927306867 2:21583605-21583627 TTGGCTCTATGGGCTTTTTTTGG + Intergenic
930106353 2:47642939-47642961 TAGGCTTTTGGGGCTTCTGTGGG - Intergenic
931539783 2:63317434-63317456 TTGGGTGTTCAGGCTTTTTTTGG - Intronic
932739166 2:74278657-74278679 CTGACACTTGAGGCTTATGTTGG - Intronic
933142950 2:78816400-78816422 TTGGCTCTTCTGGCTTCTGGTGG - Intergenic
933792455 2:85893947-85893969 TGGTCTCTTGAGGTTTTTCTAGG + Intergenic
934793164 2:97080557-97080579 TTGGCTCTTCAGGCTCTCTTTGG + Intergenic
934813023 2:97299986-97300008 TTGGCTCTTCAGGCTCTCTTTGG - Intergenic
934824672 2:97408494-97408516 TTGGCTCTTCAGGCTCTCTTTGG + Intergenic
935338652 2:102040000-102040022 TTGGCTATTCAGGCTTTTTTTGG + Intergenic
935502303 2:103856539-103856561 ATGTCTCATGAGGCTTTTGTGGG + Intergenic
936812415 2:116418098-116418120 TTGGCTATTTGGGCTTTTTTAGG - Intergenic
936840356 2:116760802-116760824 TTTGTCCTTAAGGCTTTTGTTGG + Intergenic
937354254 2:121188079-121188101 ATGGCTCTAGAGGGTTGTGTTGG - Intergenic
938158231 2:128959399-128959421 TTGGCTCATGGGGCATGTGTGGG - Intergenic
938445094 2:131370181-131370203 TTGGTTCATGAGGATTCTGTGGG + Intergenic
938612287 2:132960180-132960202 TTGGCCCTGGAGGCGTTTTTAGG + Intronic
939653242 2:144789917-144789939 TTGGCTATACAGGCTTTTTTTGG - Intergenic
940097789 2:149997753-149997775 TTGGCTATTTAGGCTGTTTTTGG - Intergenic
940598238 2:155821873-155821895 TTGGCTATTCAGGGTCTTGTAGG - Intergenic
942257994 2:174125960-174125982 TTGGCTGTTAAATCTTTTGTGGG - Intronic
943714686 2:191137538-191137560 TTGGCTCTTCAGGCTCTTTTTGG - Intronic
944791326 2:203130500-203130522 TTGTATTTTGAGGCGTTTGTGGG + Intronic
945334852 2:208580125-208580147 TTAGGTTTTGAGGTTTTTGTTGG + Intronic
946178213 2:217934794-217934816 TTGGCTCTTCAGGCATCTGCTGG - Intronic
946186994 2:217986639-217986661 TTGGGTCTTGAGGGATGTGTAGG - Intronic
946311156 2:218883376-218883398 TTGGGTCTTGAGGCTTCTTGGGG + Intronic
947357919 2:229316205-229316227 CTGGAGGTTGAGGCTTTTGTGGG - Intergenic
947883191 2:233539509-233539531 TTGGCTCTTGAGTTCTTTGGAGG - Intronic
1170162437 20:13327476-13327498 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1170205964 20:13798982-13799004 TTTCCTCTTGAAGCTTTTCTAGG - Intronic
1170413746 20:16118323-16118345 TTGGCTATTTAGGCTTTTTTTGG - Intergenic
1170899926 20:20452693-20452715 TCTACTCTTGAGGCTGTTGTGGG - Intronic
1171130776 20:22651346-22651368 TTAGCTATTCAGGCTTTTTTTGG + Intergenic
1171394564 20:24823477-24823499 TTTGTTCTTGAGGCTCCTGTAGG + Intergenic
1173458648 20:43224145-43224167 TTGCCTCTTAGGGCTGTTGTGGG + Intergenic
1173807897 20:45938120-45938142 TTGGCTCCTGAGGCTGTTGCTGG + Intronic
1174204875 20:48831006-48831028 TTGGTTCCTGAGGCTGGTGTAGG + Intergenic
1174925830 20:54758958-54758980 TTGGTTCTGAAGGCTTTTTTTGG + Intergenic
1175936036 20:62514431-62514453 TGGCCTCTTGGGGCTTCTGTGGG + Intergenic
1176222401 20:63975864-63975886 TTGGCTCTTGATGCCTCTGTTGG - Intronic
1176349354 21:5779479-5779501 TTGACTATTCAGGCCTTTGTTGG - Intergenic
1176356168 21:5900063-5900085 TTGACTATTCAGGCCTTTGTTGG - Intergenic
1176543675 21:8177549-8177571 TTGACTATTCAGGCCTTTGTTGG - Intergenic
1176562626 21:8360594-8360616 TTGACTATTCAGGCCTTTGTTGG - Intergenic
1176610137 21:8874346-8874368 CTGGTTCTTGAGACTTTTTTGGG - Intergenic
1176878356 21:14159003-14159025 TTGGGTCTGGAGACTTTTTTGGG - Intronic
1177332157 21:19678893-19678915 TTGGCTATTGATACTTGTGTAGG + Intergenic
1178000671 21:28158895-28158917 TTGTCTCTTCAGACTTTTCTTGG + Intergenic
1178465662 21:32845190-32845212 TTGTCCCTTGAGGCTTTGGCTGG - Intergenic
1178833758 21:36078675-36078697 TTGACTCTTCCAGCTTTTGTGGG - Intronic
1179187180 21:39093980-39094002 ATGGGTCCTGAGGCTTTTCTTGG - Intergenic
1180360197 22:11883599-11883621 CTGGTTCTTGAGACTTTTTTTGG - Intergenic
1181307079 22:21923019-21923041 TTGGGTCCTGAGGCTTCTGAGGG + Exonic
1182159761 22:28109842-28109864 TTGACTTTTGGGGCTTCTGTAGG - Intronic
1182644920 22:31800465-31800487 TTAGCTCTTGGGTCTTCTGTTGG + Intronic
1203248543 22_KI270733v1_random:93771-93793 TTGACTATTCAGGCCTTTGTTGG - Intergenic
950188488 3:10960143-10960165 TTGGGTCTTGGTTCTTTTGTCGG + Intergenic
950411951 3:12844365-12844387 TTGCCTCTTTAGGGCTTTGTAGG + Intronic
951607267 3:24449860-24449882 TTGGCTCTTAAGTTTTTAGTGGG + Intronic
952026260 3:29086339-29086361 TTGGGTATTCAGGCTTTTTTTGG + Intergenic
952399775 3:32952685-32952707 TTCCTTCTTGAGGCTTTTGTGGG - Intronic
955326358 3:58011571-58011593 TAAGCTCTTGAGGCTGTTGTGGG + Intronic
956475914 3:69620105-69620127 TTGTCTCTTGCTGCTTTTGGTGG - Intergenic
957758368 3:84522569-84522591 TGGGGTCTTGAGGTTTTTATAGG - Intergenic
958070481 3:88604488-88604510 TTGGCTATGTAGGCTTTTTTGGG - Intergenic
958136557 3:89501976-89501998 TTGGCTCTACAGGCTCTTTTTGG - Intergenic
958799372 3:98737867-98737889 TTGTCTTTTGTGGTTTTTGTTGG - Intronic
959390869 3:105771624-105771646 ATGAATCTTGAGGCTTTTCTAGG - Intronic
959524187 3:107357750-107357772 TTGGCTATTTAGGCTTTACTTGG - Intergenic
959846859 3:111042914-111042936 TTGGCTATTCAGGCTGTTTTTGG - Intergenic
960343258 3:116501100-116501122 TTGGCTATTCAAGCTCTTGTTGG - Intronic
960502116 3:118450449-118450471 TTGGCTCTTTAGGTTCTTTTTGG + Intergenic
960549163 3:118954375-118954397 TTGGCTATGAAGGCTTTTTTGGG + Intronic
960683763 3:120276133-120276155 TTGGCTATTCAGGCTCTTTTTGG + Intronic
961295151 3:125878687-125878709 TTGCCTCTTGTGGCTTCTGGTGG - Intergenic
962650642 3:137485849-137485871 TTGGCTATTCAGGCTCTTTTGGG + Intergenic
962889826 3:139662017-139662039 TTGCTTCTTGAGGATTTTGCGGG - Intronic
963350238 3:144142391-144142413 TTGCCTCAAGAGGCTTCTGTGGG + Intergenic
963689722 3:148483262-148483284 TTGTCTATTTTGGCTTTTGTTGG - Intergenic
963758221 3:149258669-149258691 TTGGGTCTTGGGGGTTTTATGGG - Intergenic
964075997 3:152692545-152692567 ATGACTCTTTAGGGTTTTGTAGG - Intergenic
965196549 3:165604466-165604488 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
965745786 3:171924458-171924480 TTGGCTGTGCAGGCTTTTTTTGG - Intronic
966070518 3:175871811-175871833 TTGGCTATTCAGGCTGTTTTTGG + Intergenic
966519855 3:180861100-180861122 TTGGCTACTCAGGCTTTTTTTGG - Intronic
967443618 3:189538496-189538518 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
967750092 3:193103664-193103686 TTGGCTCTTTGGGCTCTTTTTGG + Intergenic
968091178 3:195899177-195899199 TTGGATCTTGAGGAGTGTGTGGG - Intronic
969220960 4:5758179-5758201 TGGGCTCTTCTGGCTTTTGGTGG - Intronic
970233185 4:13932174-13932196 TTGCCTCTTTGAGCTTTTGTTGG - Intergenic
970262409 4:14241779-14241801 TTTGCTCCTGAGGCTTTCCTAGG - Intergenic
971207246 4:24583169-24583191 TTGGCTACTCGGGCTTTTGTGGG + Intronic
972645174 4:40961076-40961098 TTGGTTCCTGAGGTCTTTGTAGG + Intronic
973195992 4:47442483-47442505 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
973237755 4:47924134-47924156 TTGGCTGTTCAGGCTCTTTTTGG - Intronic
974456951 4:62140911-62140933 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
976157709 4:82165465-82165487 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
976428172 4:84930026-84930048 TTGGCTCCTGAGGCCTGTGAGGG - Intronic
976480569 4:85539575-85539597 TTTGCTTTTTAGGCTTTTCTAGG + Intronic
976916805 4:90386177-90386199 TTGGCTATTCAGGCTCTTTTTGG - Intronic
977462405 4:97341533-97341555 TTGGCTATGTAGGCTTTTTTTGG - Intronic
977719121 4:100218459-100218481 TTGGCTCTTCAGGCCCTTTTTGG + Intergenic
977749721 4:100594845-100594867 CAGGATCTTGAGGTTTTTGTTGG - Intronic
979040248 4:115781969-115781991 TGGCTTCTTGAGTCTTTTGTTGG + Intergenic
980255735 4:130378649-130378671 TTGGCTATTTGGGCTTTTTTTGG + Intergenic
981127688 4:141125360-141125382 TTAGTTCTTGAGGGTTTTGGTGG - Intronic
981247007 4:142552536-142552558 TAGGTTTTTGAGTCTTTTGTAGG + Intronic
981818180 4:148855337-148855359 TTAGCTTTTGAGGTTTTTCTGGG - Intergenic
982883847 4:160752881-160752903 TTGGCTATTCTGGCTTTTTTGGG + Intergenic
983503384 4:168526131-168526153 ATGGTTCTTGAGGCGTGTGTTGG - Intronic
985301050 4:188490003-188490025 TTGGCTGTTCAGGCTCTTTTTGG + Intergenic
1202769119 4_GL000008v2_random:184133-184155 CTGGTTCTTGAGACTTTTTTTGG + Intergenic
986414275 5:7512440-7512462 TGGGCTCTGGATGTTTTTGTAGG + Intronic
986844884 5:11740665-11740687 TTGTCTGTTTTGGCTTTTGTTGG - Intronic
988388753 5:30599925-30599947 TTGTCTATTTTGGCTTTTGTTGG + Intergenic
988405354 5:30817368-30817390 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
988978933 5:36544512-36544534 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
988981445 5:36573447-36573469 ATAGACCTTGAGGCTTTTGTTGG + Intergenic
992649677 5:78846354-78846376 TTGGCTATAGGGTCTTTTGTGGG + Intronic
992672782 5:79076339-79076361 TAGGGTCTTGAGGTTTTTATAGG + Intronic
992740476 5:79769085-79769107 TTGGCTATTGATACTTGTGTAGG + Intronic
993707832 5:91191553-91191575 TTGGCACTTGGGGCTTGTATAGG + Intergenic
993927085 5:93879406-93879428 TTGTCTTTTGGTGCTTTTGTTGG + Intronic
994422963 5:99545216-99545238 TTGGCTATTAAGGCTTTTTGGGG + Intergenic
994690137 5:103007507-103007529 TTGGCTCTTGTGCCTCTTTTGGG + Exonic
995653515 5:114398520-114398542 TTGGCTATTCAGGCTTTTTTTGG + Intronic
996507593 5:124285787-124285809 CTAGCTCTTGAAGCTTGTGTTGG - Intergenic
996598399 5:125231576-125231598 CTGGCTATTAAGACTTTTGTTGG + Intergenic
997671308 5:135675673-135675695 TTGGCTATTTAAGCTTTTATCGG + Intergenic
998267880 5:140679750-140679772 TGGGCTCTTGAGACTTTGGATGG - Intronic
999413638 5:151375530-151375552 TTGGCTATTTGGGCTTTTGGGGG + Intergenic
1000083365 5:157867974-157867996 TTGTCTCTTCAGGCTTTGGGTGG + Intergenic
1000582333 5:163049220-163049242 TTGTCTCTTTTGACTTTTGTTGG - Intergenic
1001916231 5:175563173-175563195 TTGGCTCTTTTGGCATTTGGGGG - Intergenic
1002382439 5:178840284-178840306 TTGGCTCTGGCTGCCTTTGTGGG - Intergenic
1002382756 5:178842045-178842067 TTGGCTCTGGCTGCCTTTGTGGG + Intergenic
1002863598 6:1101685-1101707 CTGGATCTTGAGGTTTTTGAGGG - Intergenic
1004998155 6:21214400-21214422 TTGATCCTTGAGGCTGTTGTAGG - Intronic
1005895811 6:30176686-30176708 TTGGCTATTTGGGCTTTTTTTGG + Intergenic
1007118084 6:39358110-39358132 CTTGCTCTTGAGGCCTATGTGGG - Intronic
1007820823 6:44559460-44559482 TTGGCTTTTGGGGGTTTGGTGGG - Intergenic
1007936982 6:45741175-45741197 TTGGCTCATGTTGCCTTTGTAGG + Intergenic
1009631474 6:66206789-66206811 TTAGCTCTTGAGCTTTCTGTAGG + Intergenic
1010549149 6:77200219-77200241 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
1010556049 6:77281129-77281151 TTGGCTATTTAGTCTTTTTTTGG - Intergenic
1010606309 6:77892867-77892889 TTGGATCTTGGGGCGTGTGTGGG + Intronic
1010625706 6:78134518-78134540 ATGGCTCCTGAGGCCCTTGTCGG - Intergenic
1010820462 6:80409687-80409709 TTGTCTCTTTTGACTTTTGTTGG + Intergenic
1010989825 6:82468287-82468309 TTGGCTCAAGAGGCTATTGGAGG + Intergenic
1011156224 6:84336252-84336274 TTGGCTCTGTGGGCTTTTTTTGG + Intergenic
1012206977 6:96473550-96473572 TTGGCTGTATAGGCTTTTTTTGG + Intergenic
1012710789 6:102601662-102601684 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1012940104 6:105406278-105406300 TTGGCTCTAGGGACTATTGTTGG + Intergenic
1013009247 6:106105188-106105210 GGAGCTCTTGAGGCTTTGGTCGG - Exonic
1013983462 6:116161699-116161721 TTGGCTATTTAGGCTCTTATGGG + Intronic
1014678749 6:124401444-124401466 TTGTCTCTAGATGCTTTTGGGGG + Intronic
1017190111 6:151644177-151644199 TTGGCTATGCAGGCTTTTTTTGG + Intergenic
1017410673 6:154164503-154164525 ATGGCGCATGAGGCTTTTGGAGG + Intronic
1017574538 6:155787485-155787507 TTGGCTCTTGGGGCTTGGCTTGG + Intergenic
1020738289 7:11980763-11980785 TTGGCTGTTGTGGCTCTTTTTGG - Intergenic
1021345922 7:19528489-19528511 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1022545309 7:31182043-31182065 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1023195812 7:37637772-37637794 TTGGCTGTTTGGGCTTTTTTTGG + Intergenic
1023885839 7:44355001-44355023 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1025490227 7:61108540-61108562 TTTCCTTTTGAGGCTTATGTTGG + Intergenic
1026414943 7:70169959-70169981 TTGGATCTTGAGGCTATTTAGGG - Intronic
1027144553 7:75685249-75685271 TTGGCTTTTGGGGTTTTTTTTGG - Intronic
1027730626 7:81867653-81867675 TTGCCTCTTTTGGCTTCTGTTGG + Intergenic
1028279520 7:88904424-88904446 TTGGCTATTCAGGCCTTTTTTGG + Intronic
1028337659 7:89677540-89677562 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1030174484 7:106637349-106637371 TTGGTTCTTAAGTCATTTGTGGG - Intergenic
1030412286 7:109196621-109196643 CTGGCTCTTCTGGCTTCTGTTGG - Intergenic
1031427053 7:121617669-121617691 TTGGCTTTTTAGCCTTTTCTTGG + Intergenic
1031583216 7:123502908-123502930 TTGTCTCTTTAGGTTTTTGAAGG - Intronic
1031641216 7:124166541-124166563 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1031736175 7:125364919-125364941 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1031962678 7:128004065-128004087 TTGGCCCTTGATGTATTTGTGGG + Intronic
1032256010 7:130297615-130297637 ATGGCTCTTCAGGGTTTTGCTGG - Intronic
1032709356 7:134448700-134448722 TGGGCCCTAGAGGCTTTTCTTGG + Intronic
1034254817 7:149719111-149719133 TTGCCTCTTGTGGCTTCTGGTGG + Intronic
1035005836 7:155659863-155659885 TTGCCTCTTCCAGCTTTTGTTGG + Intronic
1036507382 8:9367845-9367867 TTGGCTCTTTTGGCCTTTGGGGG - Intergenic
1037478568 8:19281783-19281805 TTGGCTATTCAGGCTCTTTTCGG + Intergenic
1038512716 8:28154979-28155001 TTGGCTTTTGATACTTTTGCTGG + Intronic
1039710045 8:40046616-40046638 TTGGCTATGCAGGCTTTTTTTGG - Intergenic
1039832493 8:41226320-41226342 TTGGCTATTGAAGCTTGTGATGG - Intergenic
1039944771 8:42119777-42119799 TTGGTTCGTGAGGCTGTTCTTGG + Intergenic
1041470766 8:58206079-58206101 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1044618567 8:94166843-94166865 TTGCCTCTTCCGGCTTCTGTTGG - Intronic
1045207789 8:100060837-100060859 TTGGCTGTTTAGGCTCTTTTTGG - Intronic
1046200984 8:110927297-110927319 TTGGCTCTTGGGAGTTGTGTGGG + Intergenic
1048250486 8:132862899-132862921 TTGGCTCAAGAGGCTTTTCTGGG + Intergenic
1048671755 8:136730491-136730513 TAGGGTCTTGGGGCTTTTATAGG + Intergenic
1048763248 8:137820102-137820124 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1050385982 9:5091487-5091509 TTGATTCATGAGGATTTTGTAGG + Intronic
1051597010 9:18834158-18834180 TTGGCTATTAGGGCTTTTTTTGG + Intronic
1051611213 9:18963276-18963298 TTGGCTATACAGGCTTTTTTTGG + Intronic
1053311211 9:37021593-37021615 TGGGATCCAGAGGCTTTTGTAGG - Intronic
1054932329 9:70648510-70648532 TTGGCTATTCAGGCTCTTTTTGG - Intronic
1056481177 9:87007907-87007929 TTGGCTGATAAGGCATTTGTAGG + Intergenic
1056493481 9:87131945-87131967 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
1056539960 9:87562409-87562431 CTGGGTCTTGAGGCTTTCGTCGG + Intronic
1057408673 9:94796871-94796893 TAACCTCTTGAGGCCTTTGTGGG + Intronic
1057793917 9:98142577-98142599 TTGGCTCATCTGGCTTTTCTTGG - Intronic
1058092763 9:100824460-100824482 TTGTCTATTCTGGCTTTTGTTGG + Intergenic
1058709535 9:107667419-107667441 TAGGCTCTGCAGGCTTTTCTGGG - Intergenic
1059180158 9:112204423-112204445 CTGGCTATTCAGGCTTTTTTAGG + Intergenic
1059262295 9:112989592-112989614 TTGGCTATTTGGGCTTTTTTTGG + Intergenic
1061159072 9:128882764-128882786 TAGGCTCTTGGGGCCTTTCTGGG + Exonic
1061397970 9:130353781-130353803 TTGGCTCTGGGGACTTTTGAAGG + Intronic
1203694001 Un_GL000214v1:77848-77870 CTGGTTCTTGAGACTTTTTTTGG + Intergenic
1203464944 Un_GL000220v1:77019-77041 TTGACTATTCAGGCCTTTGTTGG - Intergenic
1203558453 Un_KI270744v1:26228-26250 CTGGTTCTTGAGACTTTTTTTGG + Intergenic
1203642272 Un_KI270751v1:26215-26237 CTGGTTCTTGAGACTTTTTTTGG - Intergenic
1186094029 X:6080679-6080701 TTTGCCCTTGAAGATTTTGTGGG - Intronic
1186600564 X:11032642-11032664 TTGGCTGTTCAGGCTTTTTGTGG - Intergenic
1186789127 X:12980096-12980118 CTGGCTTCTGAGACTTTTGTAGG + Intergenic
1187543211 X:20219887-20219909 TTAACACTTGAGGTTTTTGTTGG - Intronic
1187818591 X:23260571-23260593 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1188341675 X:29009727-29009749 TTGGCTATTCAGGCTCTTTTTGG + Intronic
1189527282 X:41837433-41837455 TTAGCACTTGGGGTTTTTGTGGG - Intronic
1191163603 X:57363046-57363068 TTGGCTATTCGGGCTTTTCTTGG + Intronic
1191822000 X:65320568-65320590 TTGGCTATTCAGACTTTTTTTGG - Intergenic
1192688764 X:73336646-73336668 TTGGCTATTCAGGATTTTTTTGG - Intergenic
1192733636 X:73826978-73827000 TTGGCTCTTGAGGCTTTTGTTGG + Intergenic
1192981853 X:76352306-76352328 TTGGTTCTTGATGCTTTTAGGGG - Intergenic
1193499366 X:82255427-82255449 TTGGCTATTTAGGCTTTTTTTGG + Intergenic
1193611293 X:83634589-83634611 TTGGCTCTTCAAGCTCTTTTTGG + Intergenic
1193637086 X:83964648-83964670 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1193670894 X:84384998-84385020 TTGGCTATTTAGGCTTGTTTTGG + Intronic
1193923528 X:87458554-87458576 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1193964259 X:87965257-87965279 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1194151441 X:90329550-90329572 TTGGCCATTGAGGCTCTTTTTGG - Intergenic
1194171775 X:90594530-90594552 TTGGCTCTTCAGGATATTTTTGG + Intergenic
1194221161 X:91193239-91193261 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1194358632 X:92919233-92919255 TTGCCTATTTTGGCTTTTGTTGG - Intergenic
1194914261 X:99685539-99685561 TTGGCTATTTAGGCTTTTTTTGG - Intergenic
1195155595 X:102120426-102120448 TTGGCTATTCAGGCCTTTTTTGG - Intergenic
1196524617 X:116717841-116717863 TTGGTTTTTCAGGCTTTTTTTGG - Intergenic
1197279232 X:124515869-124515891 TTGGCTATTTAGGCTTTTTTGGG - Intronic
1197308931 X:124880019-124880041 TTGGCTACTCAGGCTTTTTTTGG + Intronic
1197325277 X:125085045-125085067 TTGGCTCTTTTGGCTTGGGTAGG - Intergenic
1197408600 X:126087539-126087561 TTGGCTATTGGGGCTCTTTTTGG - Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1198591628 X:138189506-138189528 TTGCCTCTTTAAGCTTTTGGTGG + Intergenic
1198930161 X:141848797-141848819 TTGGCTATTCAGGCTCTTTTTGG - Intronic
1199158972 X:144585801-144585823 TTGGCTCTGGATGCTTTTAGTGG + Intergenic
1199410953 X:147522255-147522277 TTGGCTATTCAGGCTCTTTTCGG - Intergenic
1199727061 X:150594038-150594060 TTGGCTTTTGGGGATTTTGAGGG + Intronic
1199842297 X:151662316-151662338 TTGGCTCATGGGGCTCTTTTAGG + Intronic
1199857237 X:151769753-151769775 TTGGCTATTTGGGCTTTTTTGGG - Intergenic
1200497804 Y:3906295-3906317 TTGGCCATTGAGGCTCTTTTTGG - Intergenic
1200518005 Y:4172276-4172298 TTGGCTCTTCAGGATATTTTTGG + Intergenic
1200557666 Y:4656992-4657014 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1202022439 Y:20479434-20479456 TTGTCTCTTTTGGTTTTTGTTGG - Intergenic