ID: 1192733812

View in Genome Browser
Species Human (GRCh38)
Location X:73829104-73829126
Sequence ATGTTGATCTTCAGGTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192733807_1192733812 0 Left 1192733807 X:73829081-73829103 CCTCAAGTGCTAGAGTGCCAGGC 0: 1
1: 0
2: 1
3: 69
4: 2312
Right 1192733812 X:73829104-73829126 ATGTTGATCTTCAGGTGGGAAGG 0: 1
1: 0
2: 1
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192733812 Original CRISPR ATGTTGATCTTCAGGTGGGA AGG Intergenic
901089870 1:6634121-6634143 GTGTTCATCTTCAGGAGGGAGGG - Intronic
906121293 1:43393201-43393223 GTGAAGATCTTCAGGTGAGAAGG + Intronic
907084901 1:51662473-51662495 AAGTGAGTCTTCAGGTGGGAGGG + Intronic
907217870 1:52881456-52881478 ATGTTGTTCTACAGGTCAGATGG - Exonic
907755066 1:57303207-57303229 AAGTTGATCTTTGGGTGGGAGGG + Intronic
907944988 1:59127785-59127807 ATGCTGATCTGCAGGTGGAGAGG + Intergenic
910484763 1:87700969-87700991 ATGCAGATCTTCAACTGGGAAGG - Intergenic
913679806 1:121179088-121179110 ATGTTGTTCTTCGGGTGCGGTGG + Intronic
914031640 1:143966738-143966760 ATGTTGTTCTTCAGGTGCGGTGG + Intronic
914157804 1:145101227-145101249 ATGTTGTTCTTCGGGTGCGGTGG - Intronic
920173237 1:204084414-204084436 TTGTTGATTTTCAGGAGGGTAGG - Intronic
920467116 1:206197624-206197646 ATGTTGTTCTTCGGGTGCGGTGG + Intronic
921291161 1:213658882-213658904 ATGTTTGTCTTCAGGTGCGGAGG - Intergenic
1064996357 10:21299955-21299977 ATGCTGCTCTTCAGATGGGCCGG - Intergenic
1067882338 10:50056997-50057019 ATATTAATCTTCGGGAGGGAAGG - Intergenic
1068472623 10:57484123-57484145 ATGTTGTTATTCAAGTGGAAGGG - Intergenic
1068841726 10:61622456-61622478 ATGTTGAACTTCAGCTTGAATGG - Intergenic
1069049274 10:63775588-63775610 ATTTTGAGTTTCAGGTAGGACGG + Intergenic
1072571835 10:96664976-96664998 ATCTACATGTTCAGGTGGGAAGG - Intronic
1076918746 10:133440625-133440647 ATGGTGACCTTCAGGTGTCATGG - Intergenic
1081156153 11:39693755-39693777 GTGTTGATATTCAAATGGGAAGG - Intergenic
1082011548 11:47453011-47453033 ATGCTGAGCTGCAGATGGGAGGG + Intergenic
1085486491 11:76868131-76868153 AGGTTGCTCTTCAGGGAGGATGG - Intronic
1086369818 11:86145299-86145321 ATGATGATTTTCAGGTGTCAGGG - Intergenic
1087274597 11:96148539-96148561 ATGTTCAGCTTCAGGCGGGTAGG - Intronic
1088453493 11:110008540-110008562 ATATTGAACATCAGTTGGGAAGG - Intergenic
1089194053 11:116681572-116681594 ATGGAGGTCTTCAGGAGGGATGG + Intergenic
1089863473 11:121611318-121611340 AAGTTGTTCTTCATGGGGGAAGG - Intronic
1090298803 11:125615679-125615701 ATTTTGATATTCTGGTGGGAGGG + Intronic
1091103568 11:132897951-132897973 ATGTTAATATTCAGGAGGGTAGG + Intronic
1091237407 11:134031359-134031381 CAGGTGATCTGCAGGTGGGAAGG + Intergenic
1092057411 12:5519418-5519440 ATGTTGTACTTGGGGTGGGAGGG + Intronic
1093093310 12:14944832-14944854 CTGTTCACCTGCAGGTGGGAAGG + Exonic
1093831516 12:23766393-23766415 ATTTTGACCTTTAGGTGGGTAGG - Intronic
1100851363 12:98715539-98715561 ATGCTGAAATTCAGGTGAGAGGG + Exonic
1102498330 12:113334703-113334725 ATGCTGATCTTCAGGTGTTGGGG - Exonic
1106046565 13:26147413-26147435 ATTTTCAGATTCAGGTGGGAAGG + Intronic
1106855806 13:33851316-33851338 ATGTTGATTTTCAACTGTGACGG - Intronic
1111502996 13:89148268-89148290 ATGTTCAGCTGCATGTGGGATGG + Intergenic
1113815797 13:113170119-113170141 ATTTTTTGCTTCAGGTGGGAGGG + Intronic
1113862708 13:113500118-113500140 GTGGTGATCTGCACGTGGGATGG - Exonic
1117494670 14:56290684-56290706 ATAATGCTCTTCAGGTGGTAAGG - Intronic
1117986738 14:61393973-61393995 ATTTTAATCTTTTGGTGGGAGGG + Intronic
1118315605 14:64724083-64724105 GTGGTGCTCTTCAGGTAGGAAGG + Intronic
1118456359 14:65948550-65948572 ATTTTGATCTTCATGAGGGCAGG + Intergenic
1120590342 14:86366494-86366516 ATGTTTATCTTCAGTTGGATAGG - Intergenic
1120826157 14:88957455-88957477 ATCTTGAGCTTCAGGTGGAAAGG - Intergenic
1120826431 14:88960270-88960292 ATCTTGAGCTTCAGGTGGAAAGG + Intergenic
1122763999 14:104052253-104052275 GTGTTTTTGTTCAGGTGGGAAGG + Exonic
1125809438 15:42525026-42525048 ATGTTTACCTTCAAATGGGATGG - Intronic
1125817017 15:42594314-42594336 ATGTTGATCCTGCGATGGGAAGG + Intronic
1129535069 15:76307063-76307085 GTGTTTATTGTCAGGTGGGAAGG - Intronic
1130379773 15:83361438-83361460 ATGTTCATCTTCAGATTGGGTGG - Intergenic
1131492986 15:92879155-92879177 GTGCTGATCTTTAGGAGGGAAGG - Intergenic
1136156097 16:28383264-28383286 AGGTTGATGTGCAGGTGGAAGGG + Exonic
1136206989 16:28732024-28732046 AGGTTGATGTGCAGGTGGAAGGG - Exonic
1139357228 16:66373725-66373747 ATGTGGCTTTTCAGATGGGAAGG + Intronic
1143411573 17:6712632-6712654 ATGTGGCTCTCCAGGTTGGAAGG + Intronic
1157557740 18:48623711-48623733 ATGTTGCTCTTCAGCTGGTGAGG + Intronic
1160396541 18:78576458-78576480 ATGGCACTCTTCAGGTGGGAGGG + Intergenic
1162532154 19:11242189-11242211 ATGTCGATCTTGAGCTGGGCTGG + Exonic
1165638262 19:37362385-37362407 CTGTTGTTCTTCAGGTGGGCTGG - Exonic
1165763809 19:38337608-38337630 TAGTTGATCTTCAGGTAGTAAGG - Exonic
1168104944 19:54160869-54160891 CTGCTGATCTCCAGGTGAGACGG - Exonic
925583090 2:5434123-5434145 TGGTTAAACTTCAGGTGGGAAGG - Intergenic
925996994 2:9301651-9301673 ATGCTGATCTTCATGTGGAGCGG - Intronic
928733062 2:34255296-34255318 ATGTAGATTTTCAGGTGAGATGG + Intergenic
929491134 2:42397346-42397368 ATGTTACTTTTCATGTGGGAAGG + Intronic
929742044 2:44612662-44612684 ATGTTGATTTTTTGGTGGGCTGG - Intronic
930409063 2:51000374-51000396 ATGGATATATTCAGGTGGGAAGG - Intronic
931263871 2:60643318-60643340 ATGTTGATCTGGATGTGTGAGGG + Intergenic
933452096 2:82467545-82467567 TTGTTGATCTTAAAGTTGGAAGG + Intergenic
935274772 2:101466634-101466656 ATGTTGACCAGCTGGTGGGAAGG + Intronic
937026209 2:118699802-118699824 CTGTTTATCTTCAGTAGGGAGGG + Intergenic
937193793 2:120131870-120131892 ATGTAGATGTTTAGGAGGGAAGG + Intronic
944300822 2:198123160-198123182 ATGCTCATCTTCAGTGGGGAGGG + Intronic
945285076 2:208074048-208074070 TTGTTGTTGTTCAGGTTGGATGG + Intergenic
945837184 2:214847278-214847300 ATGTGGATCTTCTGGTGGCCAGG - Intergenic
948300388 2:236902080-236902102 ATGTTGAAGTTCAAGTGTGATGG - Intergenic
1168850640 20:974400-974422 AAGGCGATCTGCAGGTGGGAGGG + Intronic
1171078101 20:22149555-22149577 GTGCTGAACTACAGGTGGGAAGG - Intergenic
1174053354 20:47782471-47782493 ATGCTGATCTGCAGGTGAGGGGG - Intronic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1175450416 20:59060952-59060974 ATGTTGAGCTCCAGGTGGATTGG + Intergenic
1178764059 21:35432748-35432770 AATTGGATCTTCAGGTGGCAGGG - Intronic
1182771532 22:32800357-32800379 ATGTCTCTCTTCAGATGGGAAGG + Intronic
1184636867 22:45839675-45839697 ATGTTCATCTTGGGGTTGGAGGG - Intronic
1185080740 22:48708199-48708221 AAGTTCATCTTCAGGAGGGGCGG - Intronic
954496077 3:50963601-50963623 TTGCTGTTGTTCAGGTGGGAAGG - Intronic
954874825 3:53795109-53795131 GTGCTGATCTGCAGGTGTGATGG + Intronic
956726126 3:72157923-72157945 ATGTTGAACTTCAGGGGGAAAGG - Intergenic
958099160 3:88987119-88987141 ATGTGGAACCTCAGCTGGGATGG + Intergenic
959885529 3:111495491-111495513 ATGTTGTCATTCAGGTGTGAAGG + Intronic
960620870 3:119635661-119635683 ATGTGGATCTTCTGGTGGCCAGG + Intergenic
961208736 3:125108936-125108958 ATGGTGACCTTCAGGTGGACAGG + Intronic
961706517 3:128790890-128790912 TTGTTGTTTTTGAGGTGGGAAGG - Intronic
962958908 3:140291922-140291944 ATGTGGTCCTCCAGGTGGGATGG - Intronic
965921439 3:173920101-173920123 ATGTTGATCTTCAGGCTGAAAGG + Intronic
968653169 4:1767866-1767888 AGGGTGTTCTCCAGGTGGGAGGG + Intergenic
970302389 4:14694943-14694965 AAGTTGATCTTCAGGTTAAAAGG + Intergenic
971025257 4:22583114-22583136 ATGTGGATTTTCAAATGGGAGGG + Intergenic
971634190 4:29034929-29034951 TGGTGGATCCTCAGGTGGGATGG + Intergenic
972829417 4:42797547-42797569 ATATTGATTTTCAGGTTGCAGGG + Intergenic
974110150 4:57515568-57515590 GTTTTGGTCTTCAGGTGTGAAGG - Intergenic
975762736 4:77634579-77634601 AAGTTTGTCTTCACGTGGGAAGG - Intergenic
980920185 4:139076857-139076879 ATGTTGAATTTTAGGGGGGAAGG - Intronic
981022169 4:140040440-140040462 TTGTTGATGTTCAGGTGGGAGGG - Intronic
982153530 4:152492030-152492052 ATGGTGATATTCAACTGGGAGGG - Intronic
985924970 5:3008797-3008819 ATGTTGAACTTAGAGTGGGAGGG + Intergenic
990511230 5:56491164-56491186 AGGTTGAGCTTCACGTGGGAGGG - Intergenic
991980632 5:72226819-72226841 ATCTTGAACTCCAGGTGTGATGG - Intronic
992147323 5:73864084-73864106 ATGGTGATGTACAGGTGGGAGGG + Intronic
995367421 5:111378485-111378507 ATTTGGATCTTTAGGTGAGAAGG + Intronic
996641366 5:125758593-125758615 ATGTTGATTTTCTGATGGGATGG - Intergenic
997447682 5:133953378-133953400 CTTTTGAACTTCAGCTGGGAAGG + Intergenic
998711393 5:144829256-144829278 CTGTTGATCTCCAAGTGGGCGGG + Intergenic
1001818935 5:174694545-174694567 TTATTGATCCTCAGGAGGGAGGG - Intergenic
1002853355 6:1016184-1016206 TTATAGATCTTCAGGTGGGAGGG - Intergenic
1006627895 6:35410614-35410636 ATCTGGATCTCCAGGTGGGCTGG + Intronic
1007694722 6:43724959-43724981 ATGTAGATCATCAGGGTGGAAGG + Intergenic
1008000758 6:46357205-46357227 AAGTTTATCTTCAGCTAGGATGG - Intronic
1008542905 6:52561225-52561247 AAGTGGATATTAAGGTGGGATGG + Intronic
1018149945 6:160928003-160928025 CCCTTGACCTTCAGGTGGGAAGG + Intergenic
1018978189 6:168581705-168581727 AAGCTGATGTTTAGGTGGGATGG + Intronic
1019132277 6:169885879-169885901 ATATTGATGTTCTGCTGGGAGGG + Intergenic
1020470900 7:8533435-8533457 ATGTTGATCTTTATAGGGGAGGG - Intronic
1027527059 7:79282918-79282940 ATGTAGATCTAAAGCTGGGAAGG + Intronic
1027812092 7:82916160-82916182 AGGTTGAACTTGAGGTGTGAAGG + Exonic
1028162220 7:87498584-87498606 AAGTGGATCTTGAGGTGGCAAGG + Intergenic
1028716159 7:93972054-93972076 ATGTTATTCTCCAGGTGGGAAGG - Intronic
1034080039 7:148268218-148268240 GTGGTGATGTACAGGTGGGAGGG + Intronic
1034128113 7:148692106-148692128 ATGTTGAAGTTCAAGTGTGAAGG - Intergenic
1035563958 8:628918-628940 ATGTTGACCTTGAGCTGGGGTGG - Intronic
1036209016 8:6827070-6827092 ATGTGGATCTTCAGGTTGTAAGG - Intronic
1037666205 8:20972386-20972408 ATGTTATTCTCCAGCTGGGAGGG - Intergenic
1039056365 8:33540332-33540354 ATGTGGATCTTCTGGTGGCCAGG - Intergenic
1042675864 8:71321152-71321174 AAGATAATCTCCAGGTGGGAAGG + Intronic
1044150561 8:88771247-88771269 AATTGGATCTTGAGGTGGGAGGG + Intergenic
1045723144 8:105137897-105137919 ACATTGATCTTCAGATGGCAAGG + Intronic
1051065198 9:13094053-13094075 ATGGGGACCTTCAAGTGGGAAGG - Intergenic
1052730863 9:32283630-32283652 ATGTTCATCTGCAAGTGTGATGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1059580088 9:115536075-115536097 AGGATGATCTTCAAGAGGGAGGG - Intergenic
1060219250 9:121755646-121755668 ATGTGGAGCTTGGGGTGGGAGGG + Intronic
1189865545 X:45323532-45323554 ATTTGGGTCTGCAGGTGGGAGGG - Intergenic
1190644206 X:52509861-52509883 CAGTAGATTTTCAGGTGGGAAGG - Intergenic
1192534535 X:71916057-71916079 AAAAGGATCTTCAGGTGGGAAGG + Intergenic
1192733812 X:73829104-73829126 ATGTTGATCTTCAGGTGGGAAGG + Intergenic
1193765289 X:85521349-85521371 ATGGTGATCAGAAGGTGGGAAGG - Intergenic
1195164857 X:102209285-102209307 ATTAAGATCTTGAGGTGGGAAGG + Intergenic
1195194001 X:102477806-102477828 ATTAAGATCTTGAGGTGGGAAGG - Intergenic
1196004769 X:110823873-110823895 ATTTTTATCTTCAGGAGGGTTGG - Intergenic
1197498375 X:127214727-127214749 ATGGTGATATACAGATGGGAAGG - Intergenic
1197812113 X:130454178-130454200 AACTTTATCTGCAGGTGGGAAGG + Intergenic
1200080058 X:153571843-153571865 ATGCTGATGTTCAGCTGGGATGG - Intronic
1200358229 X:155574404-155574426 AAGTGGATCTGCATGTGGGATGG - Intronic