ID: 1192735822

View in Genome Browser
Species Human (GRCh38)
Location X:73848841-73848863
Sequence GTGTTTTACATATTAATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192735819_1192735822 9 Left 1192735819 X:73848809-73848831 CCTAGACTAATGAGTGGGACTAT 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1192735822 X:73848841-73848863 GTGTTTTACATATTAATGCAAGG 0: 1
1: 0
2: 1
3: 14
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192735822 Original CRISPR GTGTTTTACATATTAATGCA AGG Intergenic
901189619 1:7401208-7401230 GTGTTTTTCTTTTTAATGTATGG + Intronic
903541581 1:24099449-24099471 GTGTGTTAAATATTAATTCCTGG + Intronic
904426395 1:30426263-30426285 GTGTTTTAAATATTAAGTAATGG - Intergenic
905699833 1:40003409-40003431 GCATTTTACATATTATTGCTTGG - Intergenic
905997423 1:42393287-42393309 TTGTTTCACATATTCATTCAGGG - Intronic
907134458 1:52126204-52126226 GTTATTTACATAGTGATGCATGG + Intergenic
908265651 1:62377060-62377082 CTGTTTTACATTTTAATAAATGG - Intergenic
909012027 1:70345561-70345583 GTTTTTCAAATATCAATGCATGG - Intronic
909196475 1:72632573-72632595 GTGTTTCAAATATTTCTGCATGG - Intergenic
909460862 1:75912023-75912045 CTGTTTTACATATTATTTCTTGG + Intronic
910000202 1:82332202-82332224 GAGTTTTTCATATCAATTCAAGG + Intergenic
911252088 1:95588055-95588077 GTGATTTACATATTAATTTAAGG + Intergenic
911765233 1:101666454-101666476 GTAATTTACACATTAATGGAAGG - Intergenic
913569207 1:120103267-120103289 GTATTTTAGACATTTATGCATGG - Intergenic
914290018 1:146264258-146264280 GTATTTTAGACATTTATGCATGG - Intergenic
914551061 1:148715041-148715063 GTATTTTAGACATTTATGCATGG - Intergenic
919380904 1:196859588-196859610 GTGTTTTACATGTTAATGATTGG + Intronic
919636167 1:200005752-200005774 GTGTGTTACTTATTACTGAAAGG - Intergenic
920655689 1:207872916-207872938 CTATTTTTCATATGAATGCAAGG + Intergenic
921598588 1:217082151-217082173 GTACTTTACATATTACTTCAGGG - Intronic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
924004209 1:239589546-239589568 AAATTTCACATATTAATGCATGG - Intronic
1063444135 10:6098046-6098068 ATGTTTTACATGTTATTTCAAGG - Intronic
1064576727 10:16753453-16753475 CTGTGTTACAAATTAATGGAAGG + Intronic
1065501094 10:26383243-26383265 GTGTTTTATATGTGTATGCAAGG + Intergenic
1071749976 10:88464183-88464205 CTCTTTTTCATTTTAATGCATGG - Intronic
1072582646 10:96752731-96752753 ATATTTTACATATGAATTCAAGG + Intergenic
1074096410 10:110317537-110317559 GTATTTTTCATTTTCATGCATGG - Intergenic
1075173525 10:120138027-120138049 GCATTTTATATATTAATTCAGGG - Intergenic
1078846714 11:15125098-15125120 GTGGTTTATATATTTATACAGGG + Intronic
1079498836 11:21077988-21078010 GTGTTCTACAGATGAATGTATGG - Intronic
1079916389 11:26373060-26373082 GATTTATACATATGAATGCATGG + Intronic
1083038840 11:59667667-59667689 ATGTCTTACATTGTAATGCAGGG + Intronic
1083892238 11:65601431-65601453 GTGTTTAACATGTTGATGCCTGG + Intronic
1086033613 11:82389948-82389970 ATGTTTTTCATATTTATGCATGG - Intergenic
1086209788 11:84305912-84305934 GTGCTTTAAAGATTAATGTATGG + Intronic
1086781562 11:90912529-90912551 GTGTTTTGCATATTAAAATATGG - Intergenic
1087114031 11:94504207-94504229 GGGTTTTAAAGAGTAATGCAGGG + Intergenic
1087999291 11:104855511-104855533 GTGTTTTACAAAGCATTGCAAGG - Intergenic
1088281231 11:108137234-108137256 GTGTTTTACATGTTGGTGGATGG + Intronic
1088477035 11:110251238-110251260 ATTTTTTGCATATTAATACAAGG - Intronic
1089409462 11:118227734-118227756 GTGTTGTGAAGATTAATGCAGGG - Exonic
1089876647 11:121728395-121728417 GTCTTTTATTTATTTATGCAGGG + Intergenic
1090350545 11:126105094-126105116 GTTATTTACATAATAATACAGGG - Intergenic
1091430926 12:433731-433753 ATGTTTTCCATATTCATGAAGGG - Intronic
1093134515 12:15434555-15434577 GTGTTATTCACATAAATGCATGG + Intronic
1095850959 12:46805637-46805659 CTGTTTTGAATTTTAATGCATGG + Intronic
1097506058 12:60472075-60472097 ATGTGTTTCATATTCATGCAAGG - Intergenic
1097533515 12:60836366-60836388 ATATTTTACATATTAATGATAGG - Intergenic
1100263378 12:92953388-92953410 GGGTTTTATATATATATGCAAGG + Intergenic
1101074594 12:101115541-101115563 GTGTTTTACATACAAAAGCTTGG - Intronic
1101513601 12:105414475-105414497 TTGTTTCACATATAAATACAAGG - Intergenic
1103045579 12:117732128-117732150 GGGTTTTACCTATTAACTCAGGG - Intronic
1103571641 12:121848906-121848928 GTATTTTCCATGTTAGTGCAAGG + Intronic
1105298872 13:19115727-19115749 GTGTTTTACGTAGTTATTCAAGG - Intergenic
1105796492 13:23859241-23859263 GTGTTTTATGGATTAATACATGG - Intronic
1106317512 13:28607775-28607797 CTGATTTACGTATTAATTCACGG - Intergenic
1107997894 13:45878865-45878887 GAGTATTACATATTTATGAATGG - Intergenic
1109147639 13:58800942-58800964 GAATTTTACATATTAATAAATGG - Intergenic
1109628136 13:65005648-65005670 GTGTTATATATTTTAATTCAGGG + Intergenic
1110151726 13:72263586-72263608 GTGTTCAACTTATCAATGCAGGG + Intergenic
1111030082 13:82585494-82585516 GTATTTTACATATTAATGAAGGG + Intergenic
1111561586 13:89956557-89956579 GTTTTCTACATATTAATGTATGG - Intergenic
1113637335 13:111928769-111928791 GTGTTTTCCACATTAAAACAGGG - Intergenic
1114130894 14:19790665-19790687 GGATTTTACATCCTAATGCATGG - Intronic
1117407102 14:55414918-55414940 GAGTTTTAAATTTTAGTGCATGG + Intronic
1118233442 14:63976552-63976574 TTTTTTTTCAGATTAATGCATGG + Exonic
1119629309 14:76213488-76213510 TTATTTTACATTTTAAAGCATGG + Exonic
1121931001 14:97972135-97972157 ATGCTTTAGATATTAATGCAGGG + Intronic
1124391824 15:29266082-29266104 ATGTTCTACATGTTAATCCATGG - Intronic
1124706463 15:31970474-31970496 GGGTTTCACCTATTACTGCAAGG - Intergenic
1125144005 15:36444834-36444856 CTGTTATACATTTTTATGCATGG - Intergenic
1125146710 15:36478538-36478560 GTTTTTTAAATATAAAAGCATGG + Intergenic
1127242546 15:57133325-57133347 ATGTTGTGCATATTAATACAGGG - Intronic
1129611307 15:77060454-77060476 GTGTTTTTCATATTGATGGTTGG - Intronic
1133764999 16:8831818-8831840 GGGATTTAAATATTAATGCGCGG + Intronic
1136924669 16:34361005-34361027 GAGTGTTACATATTCAAGCATGG - Intergenic
1136979904 16:35050801-35050823 GAGTGTTACATATTCAAGCATGG + Intergenic
1137652123 16:50129738-50129760 GTATTTTTTATAGTAATGCAGGG - Intergenic
1138437513 16:57012406-57012428 TTGTTTTACATTCTAAGGCAGGG + Intronic
1140016057 16:71186729-71186751 GTATTTTACATATTAATTCCCGG + Intronic
1140071241 16:71651898-71651920 GTGTTTTACATTTTGGTCCATGG - Intronic
1146458489 17:33025390-33025412 GTGTTTTCCATTTGCATGCATGG + Intronic
1152891941 17:82886981-82887003 GAGTTTTAAAGACTAATGCAGGG + Intronic
1156775463 18:40782505-40782527 ATGTTTTGTATATCAATGCAAGG - Intergenic
1156913517 18:42439020-42439042 GTTTTTTACATATGTATACATGG + Intergenic
1157399860 18:47378222-47378244 CTGGTTTTCATATTAATGCTGGG + Intergenic
1158483455 18:57843508-57843530 GTGTTTTGCATAATGAAGCAAGG + Intergenic
1159381227 18:67662343-67662365 GTTTATTATATATTAATCCATGG + Intergenic
1159385248 18:67715657-67715679 GTATTTTTAATAATAATGCATGG - Intergenic
1159669583 18:71206378-71206400 TTGTTTTATAAGTTAATGCAAGG + Intergenic
1159855652 18:73584442-73584464 TTGTTTTAAATATTTATTCATGG - Intergenic
1164325147 19:24184704-24184726 GTGTATTGCAAAATAATGCAGGG - Intergenic
1168547699 19:57267435-57267457 GTCATTTACATAGGAATGCAGGG + Intergenic
927339426 2:21965304-21965326 GTGCTTTAAATTTAAATGCATGG - Intergenic
927584385 2:24286889-24286911 TTTTTTTACATATTCATGCAGGG + Intronic
931317297 2:61144711-61144733 GAGTTTTAAAAATTAATGCTAGG - Intergenic
932020633 2:68082560-68082582 GTTGTTTACAAATTAATGTAGGG - Intronic
932966246 2:76478704-76478726 GAGTTTTACATGTTATTACATGG - Intergenic
933139037 2:78770590-78770612 TAGTTTTACATCTTAAAGCAAGG + Intergenic
934218394 2:90056200-90056222 ATGTTTAACAAGTTAATGCAAGG + Intergenic
934908826 2:98231588-98231610 CTGTTTTACATTTAAATCCACGG - Intronic
935412382 2:102779593-102779615 GTGTTTTACAGCTGAATGAAGGG - Intronic
935669204 2:105541089-105541111 CTTTTTTGCAGATTAATGCAGGG + Intergenic
938449635 2:131405672-131405694 AAGGTTTAGATATTAATGCAAGG + Intergenic
939559754 2:143718486-143718508 TCTTTTTACATATTAATGAATGG - Intronic
943149361 2:184092107-184092129 CTTTTTTATATATTAATACATGG + Intergenic
944442340 2:199754826-199754848 GTGTTTTACTTTTTAATTAACGG - Intergenic
947692988 2:232156951-232156973 GTGTTTTATATGTTAATAAATGG + Intronic
948407678 2:237734620-237734642 GTGTTTGATATATTAATAAATGG + Intronic
948614283 2:239188343-239188365 GTGTCTTACATATAAAGGAAGGG + Intronic
1170234166 20:14083501-14083523 GTGGTTTACAAACTGATGCATGG + Intronic
1170502247 20:16986767-16986789 GTGTTTTATATATGAGTGTAAGG - Intergenic
1171340551 20:24423778-24423800 GTGATTTCCATATTATTTCAGGG - Intergenic
1174658336 20:52190686-52190708 GTGCTTTTCACAGTAATGCAAGG + Intronic
1174710041 20:52694912-52694934 GTATTTGACATATGAAGGCATGG + Intergenic
949240551 3:1866064-1866086 GTAATTTACATAGTAATTCATGG - Intergenic
953352315 3:42224499-42224521 TTTTTTTACATATATATGCAGGG + Exonic
955128746 3:56141772-56141794 GAGTTTTTCATAGTAATGCCAGG - Intronic
955919321 3:63938885-63938907 TAGTTTCAGATATTAATGCATGG + Intronic
956016161 3:64885557-64885579 GTTTTTTACATATGTATACATGG + Intergenic
957162334 3:76626161-76626183 GTGTTTTCCATTTCAATACATGG - Intronic
958758596 3:98279535-98279557 GAGTTTAACATATAAATGCTAGG + Intergenic
959600084 3:108172058-108172080 ATGTTTTAAATGTCAATGCATGG - Intronic
963080572 3:141389670-141389692 GTGTTTTAATTATAAATGCCTGG - Intronic
963653623 3:148016954-148016976 GTGTTTTACATTTTAACATATGG - Intergenic
964537650 3:157741864-157741886 GTAGTTTACATAGAAATGCAAGG + Intergenic
967315423 3:188148340-188148362 GTTATTTTCATATTAATGGAGGG + Intergenic
967791491 3:193553873-193553895 GTTATTTACATATTAATTCCAGG + Intronic
969958503 4:10917831-10917853 GTGTTTTACATGTTAAAATAAGG - Intergenic
970147468 4:13052073-13052095 ATGTATAACATATTAGTGCATGG - Intergenic
970255458 4:14164712-14164734 CTGTATTACATACAAATGCATGG + Intergenic
972212978 4:36860826-36860848 GTGTTTGAAATATGCATGCAAGG - Intergenic
972523160 4:39881573-39881595 GAGTTGTACATTTTAATTCAGGG - Intronic
973325809 4:48860672-48860694 GTCTTTTACTTATTATTGCTTGG + Intronic
974896678 4:67948466-67948488 GTTTTTTATATATAAATGCCAGG + Intronic
974903183 4:68025943-68025965 GAGTTTTGTATATTAATGTAGGG - Intergenic
975070976 4:70137776-70137798 ATGTGTTACATATTAATTTATGG - Intronic
975784484 4:77873252-77873274 GTGTTTTACAGATGAAGGAATGG + Intronic
976780002 4:88748295-88748317 AGGTTTTACATAATAATTCAGGG - Intronic
977441276 4:97070860-97070882 GATTTTAACATATGAATGCAGGG - Intergenic
977526402 4:98151538-98151560 TTATTCTACATATTAATGGAGGG + Intergenic
978051634 4:104207617-104207639 ATATTTTACATCTTAATGTAAGG + Intergenic
978880068 4:113691161-113691183 GTCTTTTTAATATTAATGGAGGG - Intronic
978994155 4:115129638-115129660 GTGTTTTATATTTTGCTGCAAGG + Intergenic
979180833 4:117724909-117724931 GTGTTTTATGTATTCATGTAAGG + Intergenic
980594548 4:134936216-134936238 GATTTTAACATATGAATGCAGGG - Intergenic
981434670 4:144706510-144706532 GTGTTTTTCATTTGACTGCAGGG + Exonic
984921471 4:184767890-184767912 ATGTTTTACATGTCCATGCAAGG + Intronic
985069719 4:186156367-186156389 GTGTTATAAAAAATAATGCAGGG + Intronic
987797573 5:22649446-22649468 ATTTTTCACATACTAATGCAAGG + Intronic
989471493 5:41824257-41824279 GTGCTTTACATGTAAGTGCATGG + Intronic
989769385 5:45125568-45125590 GTGTTTTTAATGCTAATGCATGG - Intergenic
991158916 5:63471927-63471949 ATGTTTATCAAATTAATGCATGG - Intergenic
992838736 5:80667003-80667025 TTGTTGTACATATTAATACCTGG - Intronic
993342860 5:86746197-86746219 GTATCTTACATTTTAATACAGGG + Intergenic
995074676 5:107968501-107968523 ATGTTTTCCATATTTATGAATGG - Intronic
995158748 5:108949384-108949406 CTCTTTTACATATTAATAAATGG - Intronic
995375964 5:111474807-111474829 TTGTATTACATATTAGTGGATGG - Intronic
995644950 5:114301111-114301133 GTTATTTACATAGTAATGTAAGG - Intergenic
996903875 5:128575714-128575736 GTCTTTTTCTTATTAGTGCAGGG - Intronic
997386187 5:133474646-133474668 GTGCTTTCCTTATTAATGCCAGG - Intronic
997870345 5:137500599-137500621 GTCATTCACATCTTAATGCAGGG + Intronic
997924249 5:138013666-138013688 GTGATTTAAACATTAATCCAGGG - Intronic
998634877 5:143942208-143942230 GTTTGTTACATATGTATGCATGG - Intergenic
1000097560 5:157985187-157985209 GGGTTTGACATATTAATGTTGGG - Intergenic
1002555589 5:180036592-180036614 GTGTTCTGGATATTAATGAAGGG - Intronic
1003381208 6:5626009-5626031 GTGATCTACATATTCATGTATGG + Intronic
1004566227 6:16800402-16800424 GTTAATTTCATATTAATGCAGGG + Intergenic
1005696162 6:28354683-28354705 TTGCTTTATATATTAATCCAGGG + Intronic
1007035221 6:38667149-38667171 TTGTGTTACATAGAAATGCACGG - Intergenic
1007624663 6:43237721-43237743 GTCCTTTGCACATTAATGCATGG - Intergenic
1008000157 6:46351966-46351988 TTGATTTACATCTTAATGGAAGG - Intronic
1008158928 6:48053643-48053665 TAGTTTAACACATTAATGCAAGG - Intronic
1009036170 6:58119568-58119590 GTTTTTTAAATATTAATGGCGGG - Intergenic
1009211987 6:60873187-60873209 GTTTTTTAAATATTAATGGTGGG - Intergenic
1009378761 6:63004619-63004641 ATGTTTTAAATATTTATGGATGG + Intergenic
1009688873 6:67000004-67000026 GTGTTTGAAATATTAATATATGG - Intergenic
1009748731 6:67855269-67855291 TTGTTTTAAATATTGATGCCTGG - Intergenic
1009819729 6:68785210-68785232 GTTTGTTACATATGTATGCATGG + Intronic
1011902046 6:92311106-92311128 ATTTTTTTCATATTAATGTAAGG + Intergenic
1012033592 6:94103496-94103518 ATGTTTTAAAAATTAATACAAGG - Intergenic
1012193151 6:96305833-96305855 GTCTTTTTCATATTATTGTATGG + Intergenic
1013067724 6:106699833-106699855 GTATTTCAGATATTAATCCAAGG + Intergenic
1016933797 6:149433871-149433893 GTACTTTTCATATTAATTCATGG - Intergenic
1017318411 6:153059794-153059816 GGTTTTTAAATATCAATGCAAGG + Intronic
1017845972 6:158258645-158258667 TTGCTTTAAATTTTAATGCAAGG - Intronic
1018409938 6:163534622-163534644 GTGTTTTTCATGGTAATGTAAGG + Intronic
1018420763 6:163639044-163639066 GTCTTTTACATTTTATTCCAGGG - Intergenic
1022397996 7:30008151-30008173 GTGATTCACATTTTAGTGCATGG - Intergenic
1023771780 7:43563460-43563482 TTGTTTTCCATATTAAAACAAGG + Exonic
1026399601 7:69996210-69996232 GTGTTTTGCAAATTTATGAAGGG - Intronic
1026432093 7:70357623-70357645 GTGTTTTACCTGTAAACGCACGG + Intronic
1029880004 7:103798363-103798385 GTGTTTTACAGATAAATAAATGG - Intronic
1032977809 7:137245101-137245123 GTGGTTTGCATATTAATCCACGG + Intronic
1033719254 7:144039781-144039803 GTGTTCCACATTTTAATGGAAGG - Intergenic
1037217416 8:16474051-16474073 CTGTGTTTCACATTAATGCATGG - Intronic
1038967367 8:32589459-32589481 GCTTTTTACACATTTATGCAGGG + Intronic
1039668914 8:39573599-39573621 GTGTTCTACATATTCTTACAGGG + Intergenic
1039716257 8:40112860-40112882 GCTTGTTACATATTAATACAGGG + Intergenic
1040888652 8:52292178-52292200 GTTTTTTCAATATTAATGCATGG - Intronic
1043483628 8:80677302-80677324 ATGCTTGACATATTATTGCAAGG - Intronic
1043740468 8:83804649-83804671 ATGTTTTATATAATAATGCATGG + Intergenic
1043996706 8:86826478-86826500 ATCTTATACATTTTAATGCATGG + Intergenic
1046577875 8:116054294-116054316 CTGTTTTAAACATTAATGAATGG + Intergenic
1048618114 8:136101694-136101716 GGGTTTTACGTATTGAAGCAAGG - Intergenic
1052130295 9:24837252-24837274 GAGTTTTACAAATTAATACTTGG + Intergenic
1052676002 9:31624847-31624869 TTATTTTACATATAAATGCATGG - Intergenic
1053033520 9:34803767-34803789 CCGTTTTACATATTAAAACAAGG + Intergenic
1055255360 9:74363343-74363365 GTGGTTTACTTATAAATGGAGGG + Intergenic
1058097890 9:100884141-100884163 TTGTTATACATATTAAAACAAGG + Intergenic
1060582013 9:124757575-124757597 GTGTTTTTAAAATTAATGCATGG - Intronic
1188139897 X:26536986-26537008 CTGTTTTATATATTTATCCATGG + Intergenic
1189580902 X:42405158-42405180 GTGTATTAAATATTAATTGAAGG - Intergenic
1191911128 X:66151404-66151426 ATGTCTTACAGATTAATCCATGG + Intergenic
1192639165 X:72846595-72846617 GTGTTTTGCAAATTAAAGCACGG + Intronic
1192642546 X:72874210-72874232 GTGTTTTGCAAATTAAAGCACGG - Intronic
1192735822 X:73848841-73848863 GTGTTTTACATATTAATGCAAGG + Intergenic
1193128657 X:77896409-77896431 GTGCTTTAAATATTAAGTCAAGG - Intergenic
1195247858 X:103012438-103012460 GCATTTTAAATATTAAAGCATGG - Intergenic
1195273912 X:103260099-103260121 GTGTTATACGTATATATGCATGG - Intergenic
1196369621 X:114962491-114962513 GTCTTTTACCTATGAAAGCAAGG - Intergenic
1196481195 X:116151322-116151344 GTGTTTTACATCTAAAAGGAAGG - Intergenic
1198336974 X:135675852-135675874 TTGTTTTCCATATGAATGCGTGG - Intergenic