ID: 1192736171

View in Genome Browser
Species Human (GRCh38)
Location X:73851367-73851389
Sequence CAGGAAAAGATGGCGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192736171 Original CRISPR CAGGAAAAGATGGCGGCTGA AGG (reversed) Intergenic
900929918 1:5730022-5730044 CAAGAAAAGATGGCAGATCAAGG + Intergenic
901991232 1:13115676-13115698 CATGTAAAGATGGAGTCTGAGGG - Intergenic
902756072 1:18550082-18550104 CAGGAGCAGATGGCTGCTGGGGG - Intergenic
903569731 1:24295334-24295356 AAGGAAAAGGGGGAGGCTGAGGG + Intergenic
904334627 1:29788741-29788763 TAGGAAAGGATGGAGGCAGAAGG - Intergenic
905098802 1:35499969-35499991 CAGAAAAAGAAGGCAGCAGATGG + Intronic
906300561 1:44678399-44678421 GAGGAAAAGGTGGGGGCAGATGG + Intronic
907762926 1:57379170-57379192 TAGGAAAAGATGGTGGGGGAGGG - Intronic
909962485 1:81863581-81863603 GATGAAAAGATGGCAGATGATGG + Intronic
912947238 1:114095530-114095552 CAGCACAAGATGGGGGCTCACGG + Intronic
913104217 1:115596706-115596728 CATGTAATGATGGAGGCTGAGGG + Intergenic
913613992 1:120538004-120538026 CAGGAAAAGGTGTCAGCTCATGG + Intergenic
914576275 1:148972889-148972911 CAGGAAAAGGTGTCAGCTCATGG - Intronic
914973910 1:152339964-152339986 AAGAAAATGATGGCTGCTGATGG + Intergenic
916011282 1:160708133-160708155 CAGGGAAAGATGACGACTGGGGG + Intronic
918097204 1:181345349-181345371 CAGGAAACACTGGCGGATGAAGG + Intergenic
918233993 1:182561016-182561038 CAGGAACAGATGGAGGGTGGGGG + Intergenic
920107392 1:203563623-203563645 CAGGAGGAGAAGGGGGCTGAGGG - Intergenic
920139490 1:203797652-203797674 GAGGAAAAGATGGTAGCAGAAGG + Exonic
920574775 1:207051241-207051263 CAAGAAAAGAGGGCGGGGGAAGG + Intronic
923233553 1:232010950-232010972 CAGGAAAGAATGGCTGCAGAAGG + Intronic
923611890 1:235503783-235503805 CAGAAAGCGCTGGCGGCTGAAGG + Intronic
924486324 1:244487321-244487343 AAGGGAAATATGGCGGCTGGTGG - Intronic
1065174530 10:23063737-23063759 CAGATAAAGATGGGAGCTGAGGG - Intergenic
1065830630 10:29610752-29610774 CATGAAAAGATGGAGGTTGGTGG - Intronic
1066569942 10:36760475-36760497 CAGAAATAGATGCAGGCTGAGGG - Intergenic
1067796960 10:49327702-49327724 CAGGAACTGATGGGGGGTGAGGG - Intergenic
1070325070 10:75383505-75383527 CAGGAAATGCTGGGGTCTGAGGG - Intergenic
1071333375 10:84582895-84582917 CTGGAAAAGATGGCACGTGACGG - Intergenic
1071524365 10:86349572-86349594 CAAGAAAAGATGAGAGCTGATGG - Intronic
1072752766 10:97995068-97995090 CATGGGAAGATGGCTGCTGAGGG + Intronic
1072767670 10:98108811-98108833 CAGGAAAAAATGTCTGCTGTGGG - Intergenic
1073072252 10:100802148-100802170 CTGGAAAATATGGTGGCTGTGGG - Intronic
1076615170 10:131750140-131750162 AAGGGAAAGAGAGCGGCTGAGGG - Intergenic
1076702476 10:132281232-132281254 AAGCAAAAGATGGGGCCTGAAGG - Intronic
1076775102 10:132691000-132691022 CAGGAAACGATAGCGTCAGACGG - Intronic
1076980763 11:203527-203549 CAGGAAAACATGGGGGATGAAGG + Exonic
1077480772 11:2813442-2813464 CATGAAAAGATGGCGGGGGAGGG - Intronic
1078677202 11:13433162-13433184 CATGAAAAGAGGGCAGGTGAAGG - Intronic
1079184162 11:18221366-18221388 GAGGCAAAGGTGGCTGCTGAAGG - Intronic
1082635193 11:55585676-55585698 TAGGAAAAGGTGGCAGCTGGAGG - Intergenic
1083743287 11:64722328-64722350 CTGGGAAAGATGGGGTCTGAGGG - Intronic
1084045169 11:66564038-66564060 CAGGGTAGGATGGCGGCTGGAGG + Intronic
1084659776 11:70539974-70539996 CAGGCGAAGATGGAGGCAGAGGG - Intronic
1085697923 11:78721593-78721615 AATGAAAAGATGGAGGCTTAGGG - Intronic
1088842932 11:113641885-113641907 CAGGAAAAGGTGGGGACTGATGG - Intergenic
1089520172 11:119057737-119057759 CAGAAAAAGATGTTTGCTGATGG + Intergenic
1090868275 11:130721197-130721219 CAGAAAATGATGGCTGCTGTAGG - Intergenic
1091124197 11:133081878-133081900 CAGCACACGCTGGCGGCTGAAGG - Intronic
1091324629 11:134677048-134677070 AGGGAAAAGATGGCAGCTGATGG + Intergenic
1091937379 12:4444681-4444703 CAAGAAAGGATGGGGGCTGCAGG - Intronic
1092997368 12:13962969-13962991 AAGGAAGAGGTGGCGGGTGAGGG - Intronic
1093659279 12:21735804-21735826 CATGGAAAGATGGAGGCTTAAGG - Intronic
1093997454 12:25657129-25657151 GAGGAAGAGATGGCAGCTAAGGG + Intergenic
1095950328 12:47778245-47778267 CAGGAAAAGCTGGGGGCAGTGGG + Intronic
1096984058 12:55744857-55744879 CATAAAAAGCTGGGGGCTGAGGG + Intronic
1097133323 12:56830390-56830412 CAGTAATAGATAGCGGGTGAGGG - Intergenic
1097507954 12:60499941-60499963 CAGGAAATGATTGTGTCTGAGGG + Intergenic
1097535420 12:60863828-60863850 CAGGATAAGATGAGGGATGAAGG + Intergenic
1099278823 12:80615676-80615698 CAGGAAAACTGGGAGGCTGAAGG + Intronic
1099600218 12:84725827-84725849 CAGAAAAAGATGGCTTCCGATGG - Intergenic
1100742824 12:97613854-97613876 CAGGAAAATTTGGGGGGTGATGG + Intergenic
1102218806 12:111180454-111180476 CAGGGACAGCTGGCGGCTGAAGG - Intronic
1102624866 12:114226826-114226848 CAGGAAAAGATGGGGGCCCCAGG + Intergenic
1104232246 12:126896801-126896823 CAGGAAAAGTGGTTGGCTGAGGG + Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105048939 12:133030478-133030500 CAGAAACAGAGGGCAGCTGAAGG - Intergenic
1106104080 13:26718628-26718650 CAGGAAAAGGTTGTGACTGATGG + Intergenic
1111402651 13:87761274-87761296 CAGGAACAGATGGTGGGTGGTGG + Intergenic
1112821849 13:103346717-103346739 CAGGAAAAGATGGCCCCAGCAGG + Intergenic
1114477526 14:23007333-23007355 AAGCTAAAGATGGCGTCTGACGG - Intronic
1115137706 14:30130955-30130977 CAGGAATTGATGGCAGCAGATGG - Intronic
1115309591 14:31965801-31965823 TAGGCAAAGATGGAGGCTGGTGG - Intergenic
1116941138 14:50792089-50792111 AATGAAAAGATGGGGGATGAGGG + Intronic
1117618578 14:57560274-57560296 CAGGAAACGATGGCTTCTGTAGG - Intergenic
1117679826 14:58192525-58192547 CAGGAAAAGATGGAAGGAGAGGG + Intronic
1119400125 14:74357510-74357532 CTGGAAGAGGTGGAGGCTGAAGG + Exonic
1121240640 14:92427562-92427584 CAAGAGAGGATGGCGGCAGAGGG + Intronic
1121733064 14:96199787-96199809 AAGGAAAGGATGGTGGCTGGAGG + Intergenic
1122026942 14:98885128-98885150 AAGGAAAAGAAGGAGGTTGAAGG - Intergenic
1122775719 14:104116316-104116338 CAGCAGAACATGGCAGCTGAGGG - Intergenic
1124558724 15:30751019-30751041 CATGAAAAGCTGGAGGATGAAGG - Intronic
1126348141 15:47717977-47717999 CTGGCAAAGCTGGCGGCTTAGGG + Intronic
1126564628 15:50082218-50082240 CAGGAAATCTTGGAGGCTGAGGG - Intronic
1127029441 15:54845493-54845515 CAGGAAAAGGAGGCGGGAGAAGG + Intergenic
1127921253 15:63496092-63496114 GGGGAAAAGATGGCTGCAGAGGG - Intergenic
1128062796 15:64745906-64745928 CAGGAGAAGGTAGCAGCTGAAGG - Intronic
1129120947 15:73396230-73396252 CAGGACAAGATGGCAGGTGTGGG - Intergenic
1130163111 15:81422280-81422302 TATGAAAAGATGGTTGCTGAAGG - Intergenic
1130538200 15:84802089-84802111 AATGAAGAGGTGGCGGCTGAGGG - Exonic
1131401461 15:92128741-92128763 AAGGAAAAGATGGTGGTTCAAGG + Intronic
1131514979 15:93071454-93071476 AAGGACAAGATGTCGGGTGAGGG - Intronic
1135424444 16:22325386-22325408 CAGGAAAGGAAGGAGGGTGAAGG - Intronic
1135466433 16:22690204-22690226 CAGGAAAAGAAGGCTGCAGATGG - Intergenic
1136539724 16:30922730-30922752 CCGGCAAAGATGGCGGCTGCAGG - Intergenic
1137463023 16:48682978-48683000 CTGGAATAGATGCCGGCTGCAGG + Intergenic
1139710198 16:68770289-68770311 CAGGAAAAGATGTAGTCAGAGGG - Intronic
1140408135 16:74724621-74724643 CATGACAAGCTGGGGGCTGAGGG + Intronic
1142656704 17:1399565-1399587 CAGGGAAATATGGCGGGTGGGGG - Intronic
1142995218 17:3756010-3756032 CAGGAAGAGAACCCGGCTGAGGG + Intronic
1143389822 17:6553712-6553734 CAGGAACAAAGGGCTGCTGAAGG - Intronic
1146051222 17:29555072-29555094 CAGGGAGAGAAGGCTGCTGAGGG + Intergenic
1146186803 17:30729555-30729577 AGGGAAAAGATGGCGGGTGAGGG + Intergenic
1146528757 17:33590121-33590143 CAGGAAAAGAGGGTGGATCATGG + Intronic
1146573827 17:33974875-33974897 CAGGAAAAGCTGAGGGATGAGGG - Intronic
1146594723 17:34158342-34158364 TTGGAAAAGAAGGCAGCTGAGGG + Intronic
1146980155 17:37152841-37152863 CAGGAAAATATGGGGGCAGGAGG - Intronic
1147553306 17:41460369-41460391 CAGGCAAAGATGGCGGAGGTTGG - Intronic
1153299430 18:3580455-3580477 AATGAAGAGGTGGCGGCTGAGGG - Intronic
1153369361 18:4296772-4296794 CAGGAAAATATGGGTTCTGATGG - Intronic
1157824662 18:50801908-50801930 GAGGAAAATTTGGTGGCTGATGG - Intronic
1158652944 18:59303869-59303891 AAGGAAGAGATGGCGGCTGCTGG + Intronic
1159937456 18:74380592-74380614 CAGTAAGAGATGGCAGCAGAGGG + Intergenic
1160252231 18:77212611-77212633 CAGGAAAATATGGTCCCTGAGGG - Intergenic
1164458904 19:28431095-28431117 CAGGAAAAAATGCAGGCTCAGGG + Intergenic
1165258093 19:34592132-34592154 CTGGAGGAGATGACGGCTGAGGG + Intergenic
1165591415 19:36972964-36972986 CAGCAATAGTTGGCCGCTGACGG - Intronic
1166495386 19:43299366-43299388 CAGGAAAAGATGGGTGATGTAGG - Intergenic
1166777801 19:45323225-45323247 CAGGAAGGGCTGGTGGCTGAAGG - Intergenic
1167164949 19:47792508-47792530 CAGGGAAATTTGGGGGCTGATGG - Intergenic
1167791284 19:51684228-51684250 TAGGAGGAGATGGCAGCTGACGG + Intergenic
926294437 2:11558592-11558614 CAGGAAAACAAGGGGGCTGATGG + Intronic
926312775 2:11686456-11686478 CCGGGAAAGATGGAGGCTGGTGG + Intronic
926691239 2:15735499-15735521 CAGGGATAGAAGGAGGCTGAAGG - Intronic
927894851 2:26775147-26775169 CAGGAAAAGAAGAGGGTTGAAGG - Exonic
928094941 2:28398680-28398702 CAGGAAAGCGTGGAGGCTGAAGG + Intronic
929404869 2:41630141-41630163 CAGGAAACGATGTCATCTGATGG + Intergenic
934117141 2:88808814-88808836 CAGGAAGTGATGGAGGGTGATGG + Intergenic
934975601 2:98799947-98799969 GAGGAAGCGATGACGGCTGAGGG - Intronic
935627504 2:105183530-105183552 CAGGGAATGATGTGGGCTGAAGG + Intergenic
936160582 2:110081458-110081480 CAGGAAGTGATGGAGGGTGATGG + Intergenic
936184082 2:110289896-110289918 CAGGAAGTGATGGAGGGTGATGG - Intergenic
938135187 2:128750790-128750812 CAGGAAGAAATGCCTGCTGAGGG + Intergenic
946000848 2:216480990-216481012 CAAGTAAAGATGGTGCCTGAAGG + Intronic
947592366 2:231393098-231393120 CAGGAGAAGAGGGTGGGTGACGG - Intergenic
1169271219 20:4200780-4200802 TAGGAAAAGGTGGCCCCTGATGG - Intergenic
1171016859 20:21549769-21549791 CAGCAAGAGATGGAGGCTGGAGG - Intergenic
1172301951 20:33856634-33856656 AAGGAAAAGCTGGCGGGTGCTGG - Intergenic
1172965931 20:38835313-38835335 CAGGACATGATGGGGGCTGCAGG - Intronic
1173875714 20:46369862-46369884 AAGGAAAAGATGGTGGGGGATGG + Intronic
1178696717 21:34799029-34799051 CAAGAAAGGATGGTGACTGAAGG - Intronic
1178747421 21:35266492-35266514 CAGGAAAGGAGAGAGGCTGATGG - Intronic
1179137163 21:38689762-38689784 AAGGAAAGGATGGCAACTGATGG + Intergenic
1179585033 21:42369377-42369399 CAGGAAAAGGTGGCGGGGTAGGG + Intergenic
1182294791 22:29306641-29306663 CAGGAAGCGATAGCGGCTGGAGG - Intronic
1183875145 22:40773880-40773902 CTGGCAGAGATGGCTGCTGAAGG + Intronic
1184559849 22:45255932-45255954 CAGGAAAAGGTAAGGGCTGAAGG - Intergenic
1185226152 22:49654030-49654052 CTGGAGAAGCTGGCGCCTGAGGG - Intronic
949864083 3:8532934-8532956 CAGGGAAGGATGGCTGCAGAGGG + Intronic
950192509 3:10987414-10987436 CAGGAGAAGAGGGAGGATGAGGG + Intergenic
950563507 3:13749706-13749728 CAGGAACAGATAATGGCTGAGGG - Intergenic
953322852 3:41987695-41987717 GAGCAGAAGATGGCGGCTGGAGG + Intergenic
953614836 3:44480581-44480603 CAGAAAAAGATGGAGGGTGGAGG - Intergenic
954830544 3:53417777-53417799 CTGGCAAAGATGTTGGCTGAAGG - Intergenic
955591427 3:60540048-60540070 CAGGAAGAGAGAGGGGCTGAAGG + Intronic
958648109 3:96899233-96899255 CATGTAAAGATGGAGGCAGAAGG - Intronic
959348306 3:105227805-105227827 CAGTAAAAGCTGACTGCTGAAGG + Intergenic
961552841 3:127678988-127679010 GTGGGAAAGATGGAGGCTGAGGG - Intronic
962243083 3:133767711-133767733 CAGAAAAAGATGAAGACTGAAGG - Intronic
963711502 3:148752767-148752789 CAGGAAAACATGGGGTTTGATGG - Intergenic
964394437 3:156230938-156230960 AGGGAAAAGAGGGAGGCTGAAGG - Intronic
964767580 3:160193580-160193602 CAGGATGAGATGGGGGCTGGTGG + Intergenic
965998938 3:174923158-174923180 CAGAAAAAGATGGGGGCTTATGG + Intronic
967133766 3:186496193-186496215 CAGGAAAAGCGGGCAGCTGCAGG - Intergenic
969587047 4:8100076-8100098 CAGGAGAGGGTGGCGGCTGGGGG + Intronic
969931142 4:10631999-10632021 CAGTATAACATGGTGGCTGAAGG + Intronic
972866373 4:43238181-43238203 CAGGAAAAGTGGGCCGCTGGTGG - Intergenic
973052467 4:45612064-45612086 TAGGAAAAGGTGGCAGCTGGAGG - Intergenic
974132809 4:57777457-57777479 CTGGGAAAGAAGGAGGCTGAGGG - Intergenic
977451527 4:97204909-97204931 GAGGATAAGACGGAGGCTGAGGG - Intronic
979051108 4:115934341-115934363 CAATAAAAGTTGGGGGCTGAGGG + Intergenic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
983454097 4:167940851-167940873 CAGGAAAAGATTCCGGAAGAAGG - Intergenic
985904583 5:2823403-2823425 CAAGAAGAGAAGGCGGTTGATGG + Intergenic
986444417 5:7808707-7808729 CAGGAAAGGGTGGGGGCTGGTGG - Intronic
987066706 5:14297037-14297059 CAGGAAAAGAGGGCTCCTTAGGG - Intronic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
993651619 5:90529428-90529450 CAGGTAAAGATGGTGGCAGGAGG - Exonic
995954052 5:117753224-117753246 CAGTAAAATATGGAGGCTCAAGG + Intergenic
997420604 5:133763888-133763910 CAGAAAAACATGGCAGCAGACGG + Intergenic
998018999 5:138753903-138753925 CAGGGAAGGAAGGCGGCCGAGGG - Intronic
998179208 5:139924777-139924799 CCGGAAAGGGAGGCGGCTGAGGG - Intronic
999164790 5:149539519-149539541 TAGGAAAAGATGGGGGTTGATGG + Intronic
1004058501 6:12165582-12165604 CAGGAAAATATGGCGGCATGGGG + Intergenic
1004192620 6:13477412-13477434 CAGGAAAAGATTGAGGGAGAAGG - Intronic
1005742020 6:28800937-28800959 CAGGATCAGGTGGCTGCTGAGGG - Intergenic
1006077882 6:31546007-31546029 CAAGAAAATATGGTGGCAGAGGG - Intronic
1006341941 6:33452086-33452108 AAGGAAAAGGGGGCGGCTGAGGG - Exonic
1006715771 6:36119209-36119231 CTGGAAATGATTGTGGCTGAAGG - Intergenic
1007111808 6:39317123-39317145 CAGGGAAAGATTTCGGCAGAGGG + Intronic
1010560944 6:77349736-77349758 CATGAAAAGATGGCTTCTGATGG - Intergenic
1010734724 6:79431154-79431176 CAGGAACAGCTTGAGGCTGAGGG - Intergenic
1012236485 6:96822513-96822535 CAGGGAAAGATGGCAAGTGAAGG - Intronic
1015343637 6:132130696-132130718 CAGGAAAAGAAGGCAGATGCTGG - Intergenic
1015419278 6:132987487-132987509 TAGAAAAAGATGGCGGGGGAAGG + Intergenic
1015862009 6:137691154-137691176 CAGGAGAAGATGATGGCTCAGGG - Intergenic
1016544781 6:145208816-145208838 CAGGACAGGATGAGGGCTGAGGG - Intergenic
1017632610 6:156411804-156411826 CAGGAAAAGATGGACAATGAAGG + Intergenic
1017972309 6:159323468-159323490 CAGATAAATATGGCGGATGAGGG + Intergenic
1018030025 6:159834345-159834367 CAGGAAATGGTGGGGGGTGAGGG - Intergenic
1018642466 6:165917239-165917261 CAGGAAGAGATGTCCGCTGCGGG - Intronic
1018944489 6:168337008-168337030 CAGGAAAGGATGGCGGCTACTGG - Intergenic
1019103004 6:169647282-169647304 CAGGAAAAGGTCCCGGCTGAGGG + Intronic
1019307862 7:344354-344376 CAGGAGGAGAGGGAGGCTGAGGG + Intergenic
1019542344 7:1557205-1557227 CAGGACAAGAGGTGGGCTGAGGG - Intronic
1019717571 7:2547023-2547045 CAGGAAGAGATGGAGGCTTGCGG + Intronic
1019898245 7:3999679-3999701 CAGGAGAAGCTGGAGGCTGGAGG + Intronic
1019991833 7:4697187-4697209 GAGGAAAAGAGGGAGGCTCAGGG + Intronic
1020735990 7:11950057-11950079 CAGGTAAAGGTGGCTGCTCAGGG + Intergenic
1021348274 7:19555197-19555219 CAGGAAAAGATGGCAGAATAGGG - Intergenic
1023191917 7:37592208-37592230 CAGGAGATGGTGGAGGCTGATGG - Intergenic
1024009932 7:45258931-45258953 CAGGAAAAGCTGGCACCAGAAGG + Intergenic
1026063933 7:67052629-67052651 CAGGAAAACATGACGAATGAGGG - Intronic
1026224957 7:68432089-68432111 CAGGCAAAGATGGAGGCACAAGG - Intergenic
1026768305 7:73174392-73174414 CAGACAAAGATGAGGGCTGAAGG - Intergenic
1027044768 7:74984097-74984119 CAGACAAAGATGAGGGCTGAAGG - Intronic
1027078868 7:75218259-75218281 CAGACAAAGATGAGGGCTGAAGG + Intergenic
1029438589 7:100575491-100575513 CAGGACAAGATGGGGCCTGCAGG + Intronic
1029790171 7:102835098-102835120 CAGGAAAAGATGATGACTTAGGG - Intronic
1031526648 7:122829653-122829675 CATGAAATGATGGAAGCTGATGG - Intronic
1031908953 7:127493735-127493757 CAGGAAAAGATGGGAGCCCAGGG + Intergenic
1032159122 7:129497232-129497254 CAGGGAATGATGGGGGCTAAGGG + Intergenic
1034367944 7:150568007-150568029 CAGGAGAAGCTGGATGCTGATGG + Intronic
1036626207 8:10474305-10474327 CAGGACCAGGTGGTGGCTGAGGG + Intergenic
1037898124 8:22671847-22671869 AAGGAAAAGTTGGGGGCTGATGG - Intergenic
1038184640 8:25262393-25262415 CAGGAGAACTTGGGGGCTGACGG - Intronic
1038491482 8:27975097-27975119 CAGGAAAAGAGAGAGGCTGAAGG + Intronic
1039773494 8:40712742-40712764 CAGGAAAAGATGGCACCTGGAGG + Intronic
1039897945 8:41729732-41729754 CGGGAACAGATGGAGGCTGCTGG - Intronic
1045263775 8:100601891-100601913 CAGGAAAAGGTGCCTGCTCAGGG - Intronic
1046985032 8:120378471-120378493 CTGGAAAATATGGAGGCTGAAGG + Intergenic
1047340137 8:123973150-123973172 CAGGAAGAGATGGGTGTTGAAGG + Intronic
1047857091 8:128922552-128922574 ATGGGAAAGATGGCTGCTGAAGG + Intergenic
1048142037 8:131804118-131804140 TAGGAAAAGATGGAGGGAGAGGG + Intergenic
1048582950 8:135745506-135745528 CAGGGAAAGATGGAGGATTAGGG + Intergenic
1048593762 8:135845383-135845405 CAGGAAAAGATGGCAACCAATGG + Intergenic
1049010102 8:139881780-139881802 CAGAAAAAGATGGCAGCTCTTGG + Intronic
1049387925 8:142353676-142353698 CAGGGAATGAGGCCGGCTGAGGG - Intronic
1051369661 9:16347505-16347527 CAGGAAAGGATGAGGGCTGTGGG - Intergenic
1051553714 9:18359266-18359288 ATGGAAAAGATGGAGGCTGAAGG - Intergenic
1061672231 9:132195215-132195237 CAGGGAAAGATGGTGGGTGGGGG - Intronic
1061742609 9:132717987-132718009 CTGGAAAAGAAGGCATCTGAGGG - Intergenic
1061865750 9:133491050-133491072 GAGGAAAAGCTGGAGGATGAGGG + Intergenic
1062592298 9:137279815-137279837 CGGGACGAGATGGCGGGTGAGGG + Exonic
1185688170 X:1947821-1947843 CAGGAAAAGATAGGTGCAGAAGG + Intergenic
1185688459 X:2133360-2133382 CAGGAAAAGATAGGTGCAGAAGG + Intergenic
1185779749 X:2834033-2834055 CAGGAAGAGATGGGGTCAGAGGG - Intronic
1187552096 X:20316265-20316287 CAGGAAATGTTGGTGACTGATGG + Intergenic
1187945782 X:24425269-24425291 CAGGCAAAGAAGGGAGCTGAGGG + Intergenic
1188722714 X:33543312-33543334 CAGGACAAGATGCCACCTGATGG - Intergenic
1188997230 X:36900413-36900435 CAGCCAAAGATGGCAGCAGATGG + Intergenic
1189880762 X:45489277-45489299 CAGGAAAATGTGGCGGGTCAGGG + Intergenic
1192563075 X:72140203-72140225 CAGGAACAGATGGTGGCTTGTGG - Exonic
1192640349 X:72856621-72856643 AAGGAGAAGATGGCCGCTGCTGG - Intergenic
1192641362 X:72864155-72864177 AAGGAGAAGATGGCCGCTGCTGG + Intergenic
1192736171 X:73851367-73851389 CAGGAAAAGATGGCGGCTGAAGG - Intergenic
1193174806 X:78380163-78380185 CAGGGGAAGAAGGGGGCTGAAGG - Intergenic
1194525946 X:94977779-94977801 CAGGAAAAGGTGGCTACTCAGGG + Intergenic
1197345921 X:125325886-125325908 CAAGAAAAGAAGGGGGCTGTTGG + Intergenic
1197790484 X:130249104-130249126 CAGGCAGAGATGGCCGCTCAGGG - Intronic
1200147469 X:153934205-153934227 AAGGAAAAGAAGGCGCCCGAAGG - Intronic
1201290292 Y:12415958-12415980 CAGGAAGAGATGGGGTCAGAGGG + Intergenic