ID: 1192738483

View in Genome Browser
Species Human (GRCh38)
Location X:73871286-73871308
Sequence GTATTCTTTTAGAAGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192738474_1192738483 29 Left 1192738474 X:73871234-73871256 CCTCCCGAGTAGCTGGGATTACA 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
Right 1192738483 X:73871286-73871308 GTATTCTTTTAGAAGAGACAGGG No data
1192738480_1192738483 -10 Left 1192738480 X:73871273-73871295 CCCAGCTAATTTTGTATTCTTTT No data
Right 1192738483 X:73871286-73871308 GTATTCTTTTAGAAGAGACAGGG No data
1192738479_1192738483 -5 Left 1192738479 X:73871268-73871290 CCACACCCAGCTAATTTTGTATT 0: 2235
1: 7227
2: 16245
3: 33339
4: 84100
Right 1192738483 X:73871286-73871308 GTATTCTTTTAGAAGAGACAGGG No data
1192738478_1192738483 -2 Left 1192738478 X:73871265-73871287 CCACCACACCCAGCTAATTTTGT 0: 2459
1: 16678
2: 66250
3: 136286
4: 196093
Right 1192738483 X:73871286-73871308 GTATTCTTTTAGAAGAGACAGGG No data
1192738477_1192738483 25 Left 1192738477 X:73871238-73871260 CCGAGTAGCTGGGATTACAGGCA 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
Right 1192738483 X:73871286-73871308 GTATTCTTTTAGAAGAGACAGGG No data
1192738476_1192738483 26 Left 1192738476 X:73871237-73871259 CCCGAGTAGCTGGGATTACAGGC 0: 72761
1: 205379
2: 228437
3: 173801
4: 346072
Right 1192738483 X:73871286-73871308 GTATTCTTTTAGAAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192738483 Original CRISPR GTATTCTTTTAGAAGAGACA GGG Intergenic
No off target data available for this crispr