ID: 1192742145

View in Genome Browser
Species Human (GRCh38)
Location X:73903912-73903934
Sequence AGGATTGGACTCCTGATCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192742142_1192742145 14 Left 1192742142 X:73903875-73903897 CCAGTTACATATAGTGAATTTAA No data
Right 1192742145 X:73903912-73903934 AGGATTGGACTCCTGATCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192742145 Original CRISPR AGGATTGGACTCCTGATCAT AGG Intergenic
No off target data available for this crispr