ID: 1192742552

View in Genome Browser
Species Human (GRCh38)
Location X:73907268-73907290
Sequence GAAAATGCACATATACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192742552_1192742554 1 Left 1192742552 X:73907268-73907290 CCATGGTGTATATGTGCATTTTC No data
Right 1192742554 X:73907292-73907314 TTATCCAATCTACCATTGATGGG 0: 71
1: 949
2: 6076
3: 7798
4: 5599
1192742552_1192742553 0 Left 1192742552 X:73907268-73907290 CCATGGTGTATATGTGCATTTTC No data
Right 1192742553 X:73907291-73907313 TTTATCCAATCTACCATTGATGG 0: 65
1: 1060
2: 7098
3: 13685
4: 23371
1192742552_1192742556 9 Left 1192742552 X:73907268-73907290 CCATGGTGTATATGTGCATTTTC No data
Right 1192742556 X:73907300-73907322 TCTACCATTGATGGGCACCTAGG 0: 47
1: 312
2: 1348
3: 6899
4: 12688

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192742552 Original CRISPR GAAAATGCACATATACACCA TGG (reversed) Intergenic
No off target data available for this crispr