ID: 1192748475

View in Genome Browser
Species Human (GRCh38)
Location X:73963661-73963683
Sequence CTCTGTCCTTGCCATAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192748475_1192748481 16 Left 1192748475 X:73963661-73963683 CCTGCCTTATGGCAAGGACAGAG No data
Right 1192748481 X:73963700-73963722 GGGTTCTTGCCTTGTTGTACTGG No data
1192748475_1192748477 -6 Left 1192748475 X:73963661-73963683 CCTGCCTTATGGCAAGGACAGAG No data
Right 1192748477 X:73963678-73963700 ACAGAGAACTTTCTGTATCCTGG No data
1192748475_1192748479 -4 Left 1192748475 X:73963661-73963683 CCTGCCTTATGGCAAGGACAGAG No data
Right 1192748479 X:73963680-73963702 AGAGAACTTTCTGTATCCTGGGG No data
1192748475_1192748478 -5 Left 1192748475 X:73963661-73963683 CCTGCCTTATGGCAAGGACAGAG No data
Right 1192748478 X:73963679-73963701 CAGAGAACTTTCTGTATCCTGGG No data
1192748475_1192748483 25 Left 1192748475 X:73963661-73963683 CCTGCCTTATGGCAAGGACAGAG No data
Right 1192748483 X:73963709-73963731 CCTTGTTGTACTGGAAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192748475 Original CRISPR CTCTGTCCTTGCCATAAGGC AGG (reversed) Intergenic
No off target data available for this crispr