ID: 1192748635

View in Genome Browser
Species Human (GRCh38)
Location X:73964887-73964909
Sequence TGGCAACTCTCTTGAAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192748633_1192748635 -3 Left 1192748633 X:73964867-73964889 CCATTCTTATCAGGGAATAGTGG No data
Right 1192748635 X:73964887-73964909 TGGCAACTCTCTTGAAATCCAGG No data
1192748629_1192748635 27 Left 1192748629 X:73964837-73964859 CCATTGTTTATACAGTTTAGCCA No data
Right 1192748635 X:73964887-73964909 TGGCAACTCTCTTGAAATCCAGG No data
1192748630_1192748635 7 Left 1192748630 X:73964857-73964879 CCACAGTGAGCCATTCTTATCAG No data
Right 1192748635 X:73964887-73964909 TGGCAACTCTCTTGAAATCCAGG No data
1192748627_1192748635 29 Left 1192748627 X:73964835-73964857 CCCCATTGTTTATACAGTTTAGC No data
Right 1192748635 X:73964887-73964909 TGGCAACTCTCTTGAAATCCAGG No data
1192748628_1192748635 28 Left 1192748628 X:73964836-73964858 CCCATTGTTTATACAGTTTAGCC No data
Right 1192748635 X:73964887-73964909 TGGCAACTCTCTTGAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192748635 Original CRISPR TGGCAACTCTCTTGAAATCC AGG Intergenic
No off target data available for this crispr