ID: 1192748875

View in Genome Browser
Species Human (GRCh38)
Location X:73966904-73966926
Sequence TCTAAGTTGTGGTGCCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192748875_1192748886 22 Left 1192748875 X:73966904-73966926 CCTTTGGGGCACCACAACTTAGA No data
Right 1192748886 X:73966949-73966971 TCCTGTCTCTGGGGGATTCAAGG No data
1192748875_1192748884 13 Left 1192748875 X:73966904-73966926 CCTTTGGGGCACCACAACTTAGA No data
Right 1192748884 X:73966940-73966962 CAGTAAGACTCCTGTCTCTGGGG No data
1192748875_1192748881 11 Left 1192748875 X:73966904-73966926 CCTTTGGGGCACCACAACTTAGA No data
Right 1192748881 X:73966938-73966960 CCCAGTAAGACTCCTGTCTCTGG No data
1192748875_1192748883 12 Left 1192748875 X:73966904-73966926 CCTTTGGGGCACCACAACTTAGA No data
Right 1192748883 X:73966939-73966961 CCAGTAAGACTCCTGTCTCTGGG No data
1192748875_1192748885 14 Left 1192748875 X:73966904-73966926 CCTTTGGGGCACCACAACTTAGA No data
Right 1192748885 X:73966941-73966963 AGTAAGACTCCTGTCTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192748875 Original CRISPR TCTAAGTTGTGGTGCCCCAA AGG (reversed) Intergenic
No off target data available for this crispr