ID: 1192748881

View in Genome Browser
Species Human (GRCh38)
Location X:73966938-73966960
Sequence CCCAGTAAGACTCCTGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192748878_1192748881 0 Left 1192748878 X:73966915-73966937 CCACAACTTAGATTTTGGTTGGC No data
Right 1192748881 X:73966938-73966960 CCCAGTAAGACTCCTGTCTCTGG No data
1192748875_1192748881 11 Left 1192748875 X:73966904-73966926 CCTTTGGGGCACCACAACTTAGA No data
Right 1192748881 X:73966938-73966960 CCCAGTAAGACTCCTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192748881 Original CRISPR CCCAGTAAGACTCCTGTCTC TGG Intergenic
No off target data available for this crispr