ID: 1192760769

View in Genome Browser
Species Human (GRCh38)
Location X:74094172-74094194
Sequence TTTCAGCAGCACCATGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192760764_1192760769 9 Left 1192760764 X:74094140-74094162 CCGAACCAAAAGGGATGCCAAAT No data
Right 1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG No data
1192760765_1192760769 4 Left 1192760765 X:74094145-74094167 CCAAAAGGGATGCCAAATAAGAG No data
Right 1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG No data
1192760767_1192760769 -8 Left 1192760767 X:74094157-74094179 CCAAATAAGAGTGGCTTTCAGCA No data
Right 1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192760769 Original CRISPR TTTCAGCAGCACCATGCTGG AGG Intergenic
No off target data available for this crispr