ID: 1192763562

View in Genome Browser
Species Human (GRCh38)
Location X:74120986-74121008
Sequence TGAAGAGAAGTGGAAAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192763562_1192763566 -7 Left 1192763562 X:74120986-74121008 CCTTGATTTTCCACTTCTCTTCA No data
Right 1192763566 X:74121002-74121024 CTCTTCAGGGATGAGTCATGTGG No data
1192763562_1192763567 -4 Left 1192763562 X:74120986-74121008 CCTTGATTTTCCACTTCTCTTCA No data
Right 1192763567 X:74121005-74121027 TTCAGGGATGAGTCATGTGGTGG No data
1192763562_1192763569 20 Left 1192763562 X:74120986-74121008 CCTTGATTTTCCACTTCTCTTCA No data
Right 1192763569 X:74121029-74121051 AGAAAATGCCCTCGACCTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 209
1192763562_1192763568 17 Left 1192763562 X:74120986-74121008 CCTTGATTTTCCACTTCTCTTCA No data
Right 1192763568 X:74121026-74121048 GGTAGAAAATGCCCTCGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192763562 Original CRISPR TGAAGAGAAGTGGAAAATCA AGG (reversed) Intergenic
No off target data available for this crispr