ID: 1192763566

View in Genome Browser
Species Human (GRCh38)
Location X:74121002-74121024
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192763562_1192763566 -7 Left 1192763562 X:74120986-74121008 CCTTGATTTTCCACTTCTCTTCA No data
Right 1192763566 X:74121002-74121024 CTCTTCAGGGATGAGTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192763566 Original CRISPR CTCTTCAGGGATGAGTCATG TGG Intergenic