ID: 1192764224

View in Genome Browser
Species Human (GRCh38)
Location X:74125926-74125948
Sequence TTGTATCTCCCTAATCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192764224_1192764227 2 Left 1192764224 X:74125926-74125948 CCACATGGATTAGGGAGATACAA No data
Right 1192764227 X:74125951-74125973 ATGAGATTCAGGTTTGGTGCTGG No data
1192764224_1192764230 17 Left 1192764224 X:74125926-74125948 CCACATGGATTAGGGAGATACAA No data
Right 1192764230 X:74125966-74125988 GGTGCTGGGTATAAGGTGAGAGG No data
1192764224_1192764231 21 Left 1192764224 X:74125926-74125948 CCACATGGATTAGGGAGATACAA No data
Right 1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG No data
1192764224_1192764226 -4 Left 1192764224 X:74125926-74125948 CCACATGGATTAGGGAGATACAA No data
Right 1192764226 X:74125945-74125967 ACAATCATGAGATTCAGGTTTGG No data
1192764224_1192764233 23 Left 1192764224 X:74125926-74125948 CCACATGGATTAGGGAGATACAA No data
Right 1192764233 X:74125972-74125994 GGGTATAAGGTGAGAGGATGGGG No data
1192764224_1192764229 10 Left 1192764224 X:74125926-74125948 CCACATGGATTAGGGAGATACAA No data
Right 1192764229 X:74125959-74125981 CAGGTTTGGTGCTGGGTATAAGG No data
1192764224_1192764228 3 Left 1192764224 X:74125926-74125948 CCACATGGATTAGGGAGATACAA No data
Right 1192764228 X:74125952-74125974 TGAGATTCAGGTTTGGTGCTGGG No data
1192764224_1192764225 -9 Left 1192764224 X:74125926-74125948 CCACATGGATTAGGGAGATACAA No data
Right 1192764225 X:74125940-74125962 GAGATACAATCATGAGATTCAGG No data
1192764224_1192764232 22 Left 1192764224 X:74125926-74125948 CCACATGGATTAGGGAGATACAA No data
Right 1192764232 X:74125971-74125993 TGGGTATAAGGTGAGAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192764224 Original CRISPR TTGTATCTCCCTAATCCATG TGG (reversed) Intergenic
No off target data available for this crispr