ID: 1192764231

View in Genome Browser
Species Human (GRCh38)
Location X:74125970-74125992
Sequence CTGGGTATAAGGTGAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192764224_1192764231 21 Left 1192764224 X:74125926-74125948 CCACATGGATTAGGGAGATACAA No data
Right 1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192764231 Original CRISPR CTGGGTATAAGGTGAGAGGA TGG Intergenic
No off target data available for this crispr