ID: 1192764231 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:74125970-74125992 |
| Sequence | CTGGGTATAAGGTGAGAGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1192764224_1192764231 | 21 | Left | 1192764224 | X:74125926-74125948 | CCACATGGATTAGGGAGATACAA | No data | ||
| Right | 1192764231 | X:74125970-74125992 | CTGGGTATAAGGTGAGAGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1192764231 | Original CRISPR | CTGGGTATAAGGTGAGAGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||