ID: 1192765644

View in Genome Browser
Species Human (GRCh38)
Location X:74137322-74137344
Sequence GAGGCTAAAGAGTCTATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192765644_1192765649 0 Left 1192765644 X:74137322-74137344 CCACCCATAGACTCTTTAGCCTC No data
Right 1192765649 X:74137345-74137367 AGTAGTAGCACAGAATAGATGGG No data
1192765644_1192765651 28 Left 1192765644 X:74137322-74137344 CCACCCATAGACTCTTTAGCCTC No data
Right 1192765651 X:74137373-74137395 GATGTCCTTACAGCTGAAGTAGG No data
1192765644_1192765648 -1 Left 1192765644 X:74137322-74137344 CCACCCATAGACTCTTTAGCCTC No data
Right 1192765648 X:74137344-74137366 CAGTAGTAGCACAGAATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192765644 Original CRISPR GAGGCTAAAGAGTCTATGGG TGG (reversed) Intergenic
No off target data available for this crispr