ID: 1192765651

View in Genome Browser
Species Human (GRCh38)
Location X:74137373-74137395
Sequence GATGTCCTTACAGCTGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192765647_1192765651 9 Left 1192765647 X:74137341-74137363 CCTCAGTAGTAGCACAGAATAGA No data
Right 1192765651 X:74137373-74137395 GATGTCCTTACAGCTGAAGTAGG No data
1192765644_1192765651 28 Left 1192765644 X:74137322-74137344 CCACCCATAGACTCTTTAGCCTC No data
Right 1192765651 X:74137373-74137395 GATGTCCTTACAGCTGAAGTAGG No data
1192765646_1192765651 24 Left 1192765646 X:74137326-74137348 CCATAGACTCTTTAGCCTCAGTA No data
Right 1192765651 X:74137373-74137395 GATGTCCTTACAGCTGAAGTAGG No data
1192765645_1192765651 25 Left 1192765645 X:74137325-74137347 CCCATAGACTCTTTAGCCTCAGT No data
Right 1192765651 X:74137373-74137395 GATGTCCTTACAGCTGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192765651 Original CRISPR GATGTCCTTACAGCTGAAGT AGG Intergenic
No off target data available for this crispr