ID: 1192774959

View in Genome Browser
Species Human (GRCh38)
Location X:74234104-74234126
Sequence GGTGGAGGAAATTACTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192774954_1192774959 -3 Left 1192774954 X:74234084-74234106 CCTATCGCCCATAGATAAGTGGT No data
Right 1192774959 X:74234104-74234126 GGTGGAGGAAATTACTGTACAGG No data
1192774951_1192774959 15 Left 1192774951 X:74234066-74234088 CCACCAGGAGAATTAGAACCTAT No data
Right 1192774959 X:74234104-74234126 GGTGGAGGAAATTACTGTACAGG No data
1192774952_1192774959 12 Left 1192774952 X:74234069-74234091 CCAGGAGAATTAGAACCTATCGC No data
Right 1192774959 X:74234104-74234126 GGTGGAGGAAATTACTGTACAGG No data
1192774957_1192774959 -10 Left 1192774957 X:74234091-74234113 CCCATAGATAAGTGGTGGAGGAA No data
Right 1192774959 X:74234104-74234126 GGTGGAGGAAATTACTGTACAGG No data
1192774950_1192774959 29 Left 1192774950 X:74234052-74234074 CCAGTCTAAGGGATCCACCAGGA No data
Right 1192774959 X:74234104-74234126 GGTGGAGGAAATTACTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192774959 Original CRISPR GGTGGAGGAAATTACTGTAC AGG Intergenic
No off target data available for this crispr