ID: 1192777054

View in Genome Browser
Species Human (GRCh38)
Location X:74256048-74256070
Sequence CCATCTTGTTTCATGTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192777049_1192777054 15 Left 1192777049 X:74256010-74256032 CCAGCAAAGCGGTCAGTGGCAAA No data
Right 1192777054 X:74256048-74256070 CCATCTTGTTTCATGTCTTTGGG No data
1192777047_1192777054 20 Left 1192777047 X:74256005-74256027 CCAGTCCAGCAAAGCGGTCAGTG No data
Right 1192777054 X:74256048-74256070 CCATCTTGTTTCATGTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192777054 Original CRISPR CCATCTTGTTTCATGTCTTT GGG Intergenic
No off target data available for this crispr