ID: 1192777775

View in Genome Browser
Species Human (GRCh38)
Location X:74262955-74262977
Sequence GTTAAGAACCAGACATCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192777775_1192777776 7 Left 1192777775 X:74262955-74262977 CCAAGAGATGTCTGGTTCTTAAC No data
Right 1192777776 X:74262985-74263007 GAGCCTATAGAAATTGCTAAAGG No data
1192777775_1192777777 8 Left 1192777775 X:74262955-74262977 CCAAGAGATGTCTGGTTCTTAAC No data
Right 1192777777 X:74262986-74263008 AGCCTATAGAAATTGCTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192777775 Original CRISPR GTTAAGAACCAGACATCTCT TGG (reversed) Intergenic
No off target data available for this crispr