ID: 1192783215

View in Genome Browser
Species Human (GRCh38)
Location X:74314768-74314790
Sequence ACACAATTGTCGGCCGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192783215_1192783220 9 Left 1192783215 X:74314768-74314790 CCGCGCCCGGCCGACAATTGTGT No data
Right 1192783220 X:74314800-74314822 TTTTGTTCCTTTTTGTTCTAGGG No data
1192783215_1192783219 8 Left 1192783215 X:74314768-74314790 CCGCGCCCGGCCGACAATTGTGT No data
Right 1192783219 X:74314799-74314821 TTTTTGTTCCTTTTTGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192783215 Original CRISPR ACACAATTGTCGGCCGGGCG CGG (reversed) Intergenic
No off target data available for this crispr