ID: 1192786792

View in Genome Browser
Species Human (GRCh38)
Location X:74344080-74344102
Sequence GTCATTACTCAGAAGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192786792_1192786797 -4 Left 1192786792 X:74344080-74344102 CCTTTCCCCTTCTGAGTAATGAC No data
Right 1192786797 X:74344099-74344121 TGACCCGGTACAGTTGCCTCTGG No data
1192786792_1192786801 16 Left 1192786792 X:74344080-74344102 CCTTTCCCCTTCTGAGTAATGAC No data
Right 1192786801 X:74344119-74344141 TGGATAGTCTCCTGCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192786792 Original CRISPR GTCATTACTCAGAAGGGGAA AGG (reversed) Intergenic
No off target data available for this crispr