ID: 1192786845

View in Genome Browser
Species Human (GRCh38)
Location X:74344530-74344552
Sequence GTGGGCTGGCTGATCTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192786845_1192786856 22 Left 1192786845 X:74344530-74344552 CCAGGAAAGATCAGCCAGCCCAC No data
Right 1192786856 X:74344575-74344597 GCTAGAAGTTGTAAGATCCACGG No data
1192786845_1192786852 -2 Left 1192786845 X:74344530-74344552 CCAGGAAAGATCAGCCAGCCCAC No data
Right 1192786852 X:74344551-74344573 ACCTGGGTCCCTCGCTAGGCAGG No data
1192786845_1192786849 -6 Left 1192786845 X:74344530-74344552 CCAGGAAAGATCAGCCAGCCCAC No data
Right 1192786849 X:74344547-74344569 GCCCACCTGGGTCCCTCGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192786845 Original CRISPR GTGGGCTGGCTGATCTTTCC TGG (reversed) Intergenic
No off target data available for this crispr